1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ollegr [7]
3 years ago
8

List 3 items that stand out about education in South Korea

Geography
1 answer:
Natasha2012 [34]3 years ago
3 0
1. School on weekends 2x a month
2. 16 hour work days
3. Students clean the school after each day instead of janitors
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which statement most accurately describes how geography affected the growth of the ancient civilizations of the Egypt and Mesopo
KATRIN_1 [288]

The earliest of civilizations were based around river valleys. This allowed them to irrigate fresh water to their crops allowing for better farming and therefore, bigger and better civilizations.

4 0
3 years ago
Read 2 more answers
Which of the following groups are most likely to grow as a percentage of the U.S. population Asian Americans Whites African Amer
iren [92.7K]

Answer:

I'd say all of the above because no particular group is more fit than the other for sexual reproduction, if the question was who would have the quickest reproductive rate then you could base that off of population size of X race.

8 0
3 years ago
Which form of democratic government does Canada have?
Vaselesa [24]
 Best Answer:  It's both. It's a Constitutional Monarchy (Queen is head of state, has a lot of powers, but doesn't use them often), and it's a parliamentary democracy where Parliament is the legislative body and is democratically elected (or well, the House of Commons at least anyway).<span>
</span>
8 0
3 years ago
Who is considered the Messiah in Christianity
diamong [38]
The answer is D. Jesus
3 0
3 years ago
Read 2 more answers
Other questions:
  • What was one effect of European influence on Southeast Asia?
    12·1 answer
  • A blank satellite records reflected wavelengths from earth's surface
    15·1 answer
  • Fossils of tropical plants have been found in the Earth’s polar regions. How could this be explained?
    11·2 answers
  • Two stage cooling of molten rock material, slow rate followed by fast rate produces _______ texture​
    5·1 answer
  • In which of the following regions were most of the world's urban centers located between 1350 BC and AD 1600?
    5·1 answer
  • Erosional processes are the most important factor in the formation of river landforms.’ To what extent do you agree with this st
    15·1 answer
  • Please help me a #5<br><br><br><br><br><br> ....................
    7·1 answer
  • The map below shows the average annual
    7·1 answer
  • his relatively large, symmetrical volcano contains interlayered lava flow, pyroclastic deposits, and volcanic mudflows. What kin
    6·1 answer
  • All of the following are causes of physical weathering except
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!