1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
3 years ago
6

What are 10 facts about the Great Plains?

Geography
1 answer:
ollegr [7]3 years ago
8 0
Hi there

Facts about the Great Plains

1) They support one of the lowest population densities in the United States

2) Occupy around 500,000 miles of west-central North America

3) Millions of American bison roamed the Great Plains before their near-extermination by market hunters in the late 1800s

4) Through dedicated conservation efforts, bison have made an impressive comeback both on public and private lands.

5) Along wildlife other than bison were pronghorn, elk, mule deer, white-tailed deer, etc.

6) Cast in the rainshadow of the Rockies, the Great Plains harbor the greatest remaining expanses of prairie, a highly-endangered habitat, in the country.

7) While many presume the Great Plains to be relentlessly level, the province actually contains much topographic variety.

8) There are island mountain ranges, especially on the Missouri Plateau---the Bears Paw Mountains, the Sweetgrass Hills, the Black Hills, for example.

9) The Great Plains of interior North America constitute one of the largest grassland expanses in the world

10) For thousands of years, human cultures as varied as the Kiowa, the Blackfeet, the Spanish and the Americans have explored, hunted, settled and fought over these vast spaces.
You might be interested in
Image courtesy of NASA and the CIA World Factbook
Alexus [3.1K]
C. Saudi Arabia is the answer.
7 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
In FOUR points, analyse the negative impact of radiation on the economy of the country​
Travka [436]

The negative impacts of radiation on a country's economy may include :

  • Increased rate of mortality
  • Destruction of food crops and cattles
  • Environmental contamination
  • Long term health complications

Radiation has proven to be very useful in medicine, power, defense and other sectors if adequately deployed. However, it's negative impact can also be overwhelming.

Some of the negative impacts of radiation include :

  • Radiation could cause death thousand to millions of people within minutes. Such could result from bomb attacks or release of toxic nuclear substances into the environment.

  • The effect of radiation does not only pose risk to life, it could also lead to destruction of crops and cattles. Causing famine and unquantifiable losses.

  • Nuclear radiation may be so deadly that it renders several Radius or perimeter of an environment inhabitable. Such is the situation of Hiroshima and Nagasaki.

  • Nuclear radiation often poses the risk of terminal diseases such as cancer upon exposure .

Learn more : brainly.com/question/11878930?referrer=searchResults

4 0
2 years ago
Is the USA a part of North America or South America?.
kifflom [539]

North America. Included with Canada and Mexico.

5 0
2 years ago
Most of the population of Northern Ireland is _______.
omeli [17]

Answer:

The right answer is A.

Explanation:

6 0
3 years ago
Other questions:
  • In India, the introduction of Sanskrit, Hinduism, and the caste system all occurred during the time period of __________.
    13·2 answers
  • If you want to keep cool on a sunny day, why should you wear a white shirt?
    11·2 answers
  • 4. What are the characteristics and relative abundance of sediments based on their
    11·1 answer
  • Por favor ayúdenme a contestar estas pregunta cada una de 80 palabras por lo menos ¿Crees estar inserto en un mundo globalizado?
    10·2 answers
  • Benefits from increased development include _____.
    12·1 answer
  • Why did the senators decide to assasinate julius caesar?
    12·1 answer
  • Someone please help me it's soo hard.​
    7·2 answers
  • The temperature of the areas surrounding Santa Catarina before each storm was about 13°C, and there was the same amount of water
    9·1 answer
  • Are zebras really a hybrid?
    8·2 answers
  • Which resources are widespread in both Australia and new zeland
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!