C. Saudi Arabia is the answer.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
The negative impacts of radiation on a country's economy may include :
- Increased rate of mortality
- Destruction of food crops and cattles
- Environmental contamination
- Long term health complications
Radiation has proven to be very useful in medicine, power, defense and other sectors if adequately deployed. However, it's negative impact can also be overwhelming.
Some of the negative impacts of radiation include :
- Radiation could cause death thousand to millions of people within minutes. Such could result from bomb attacks or release of toxic nuclear substances into the environment.
- The effect of radiation does not only pose risk to life, it could also lead to destruction of crops and cattles. Causing famine and unquantifiable losses.
- Nuclear radiation may be so deadly that it renders several Radius or perimeter of an environment inhabitable. Such is the situation of Hiroshima and Nagasaki.
- Nuclear radiation often poses the risk of terminal diseases such as cancer upon exposure .
Learn more : brainly.com/question/11878930?referrer=searchResults
North America. Included with Canada and Mexico.