1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
15

What does it mean to say a food is a complete protein source

Biology
1 answer:
Oksana_A [137]3 years ago
7 0
It means that a food has all the essential amino acids a human body needs

Like:
meat
poultry
fish
eggs
milk
and cheese
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
It was my first day in the class. I was very nervous as the college was away from my home town. I had to stay away from my paren
stira [4]

Answer:

Perhaps try adding a conflict? If a story's all happy-go-lucky, it won't draw the reader's interest. For example,

- Sabotage by a so-called friend

- Becoming I'll

- Group Project

- Being given an assignment that you're scared to do (for example, public speaking.

4 0
2 years ago
While performing an experiment at home, Emma adds lemon juice to a soap solution. How will this affect the pH of the soap soluti
kirza4 [7]
The pH will decrease because lemon juice is very acidic meaning it would bring the pH level down to a more acidic value.
4 0
3 years ago
Malaysia is a country which is rich with wide biodiversity of natural resources. Various methods are
Lerok [7]

Answer:

Malaysia is a beautiful country and rich in biodiversity of natural resources. People in Malaysia take several steps to protects its biodiversity and it is one of the beautiful tourism spot as well. If no steps are taken to  protect the species, there may be following effects:

  • Loss of biodiversity and species can become endangered or extinct.
  • Can lead to environmental disasters due to imbalance in biodiversity.
  • Habitat loss of plants and animals.
  • Climate can change due to ecosystem instability.
  • Tourism will reduce in Malaysia that can affect it economically as well.

6 0
3 years ago
A louse species (an external parasite) infests salmon. Researchers have found that lice have difficulty finding a mate when ther
agasfer [191]

Answer:

LW5unhealthy

Explanation:

physics

7 0
3 years ago
Other questions:
  • Which description refers to cumulus clouds?
    5·1 answer
  • How can biological weathering result in chemical erosion?
    6·1 answer
  • Why do scientists classify a sponge as a simple animal and not a plant?
    7·1 answer
  • What is the genotype of the parent with orange eyes and white skin? (Note: orange eyes are recessive.)B=black eyes G=green skinb
    5·1 answer
  • You are standing at position X. Click on the diagram that shows your position when you perceive a sound at the same frequency as
    5·1 answer
  • Which below toward the low-pressure areas of the westerlies?
    7·2 answers
  • Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one
    8·2 answers
  • We have learned to:
    8·2 answers
  • By the end of this lab, you will see how some materials diffuse through a semipermeable membrane but others do not. The material
    8·1 answer
  • When bacteria make their own food they are called
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!