1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vsevolod [243]
3 years ago
9

The Devonian marked the time of greatest diversity in which of the following?

Biology
1 answer:
USPshnik [31]3 years ago
5 0
I would say that the fishes exhibited the greatest diversity (though the brachiopods also had considerable diversity) and mostly were of the ostracoderms (with a platey or shell-like skin and no jawbone) which exhibited many varieties and also the placoderm which had gills, a jawbone and fins so was developing characteristics of modern fish. 
You might be interested in
Many species get their food by eating other organisms this is called
dalvyx [7]

Answer:

a

Explanation:

6 0
3 years ago
Read 2 more answers
Endorsements by celebrities
Sergio [31]

Similar results in multiple tests of the claim is an example of a scientific claim.

<h3>What is Scientific claim?</h3>

These are referred to statements which are made based on experimental results in the field of science.

The results gotten must also be similar to a large extent when performed by others in order to ascertain its validity.

Read more about Scientific claim here brainly.com/question/717323

#SPJ1

The full question is:

Which factor is found in a scientific claim?

6 0
2 years ago
Day and night are caused by Earth's revolution on its axis.<br> T or f
xenn [34]

Answer:

i belive it is true

Explanation:

We get day and night because the Earth spins (or rotates) on an imaginary line called its axis and different parts of the planet are facing towards the Sun or away from it. It takes 24 hours for the world to turn all the way around, and we call this a day.

6 0
3 years ago
Read 2 more answers
How organisms obtain energy from food through cellular respiration?
frozen [14]

Hope the attachment helps

8 0
2 years ago
Read 2 more answers
The atomic mass of common krypton is 84, and its atomic number is 36. Krypton-82 has how many neutrons within each isotope? A. 4
PtichkaEL [24]
The correct answer would be A. The number of neutrons present in Krypton-82 would be 46. The atomic number of an atom represents the number of protons present while the mass number is the sum of the neutrons and protons in the atom. The mass number for the given atom is 82. So, 82-36 = 46 neutrons present.
5 0
3 years ago
Read 2 more answers
Other questions:
  • ____ is a type of cell division that produces gametes
    6·2 answers
  • A father has dimples, the mother does not have dimples, and all four of their children have dimples. Dimples (D) are dominant ov
    15·1 answer
  • Which best describes meiosis?
    8·2 answers
  • An apple falls off a tree onto the ground. Which of the following best describes what eventually happens to the material that ma
    14·1 answer
  • Wind with the speed of less than 50 km/h is called
    6·2 answers
  • A biologist discovers two populations of wolf spiders whose members appear identical. Members of one
    7·1 answer
  • Help please will mark BRAINLIST!
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • ⚠️40 POINTS!!⚠️
    5·2 answers
  • Bantu jawab IPS, a-c no 1
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!