1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
4 years ago
14

What is the term for an observable trait of an organism??

Biology
1 answer:
babymother [125]4 years ago
7 0
I believe the term for an observable trait of an organism would be called or noted as the organism's phenotype.
You might be interested in
Which of the following is true of eukaryotes but not of prokaryotes
ddd [48]
They must contain nucleus
7 0
3 years ago
Read 2 more answers
Cars are the leading cause of: air pollution water pollution deforestation fossil fuel consumption
icang [17]

The combustion of fossil fuels like coal, petroleum and other factory combustibles is a major cause of air pollution. ... Meanwhile, emissions caused by gasoline-burning vehicles – i.e. CO, CO², nitrogen oxides, particulates and water vapor – are also a significant source of air pollution.


I say Air Pollution

5 0
3 years ago
Examples of patterns in nature​
Archy [21]

Answer:

Natural patterns include symmetries, trees, spirals, meanders, waves, foams, tessellations, cracks and stripes. Early Greek philosophers studied pattern, with Plato, Pythagoras and Empedocles attempting to explain order in nature.

Explanation:

Hope this helps you

Do mark me as brainliest:)

5 0
3 years ago
Read 2 more answers
. Part of the brain which is the control center for all regulatory activities of the body: ___________________________ 2. Condit
ElenaW [278]

Answer:

The correct answer is -

Hypothalamus

Hypothyroidism

Explanation:

Hypothalamus is the part of the brain that has many small nuclei and nerves in it and plays various kinds of roles in the nervous systems. The major roles of the hypothalamus are maintaining homeostasis, acts as the control center as it controls all regulatory processes of the body.

Hypothyroidism is a condition of the underdeveloped thyroid gland or not able to produce enough amount of thyroid hormones. The absence or less thyroid hormone causes weight loss and tiredness in a person.

8 0
3 years ago
Which of the following is a main function of the circulatory system?
IgorLugansk [536]

B.  transport oxygen to tissues

5 0
3 years ago
Other questions:
  • What factors have caused a rapid increase in human population?
    15·1 answer
  • Which of the following is NOT a form of energy?
    5·2 answers
  • An ride share company $1.75 plus $0.55 per mile. You were charged a total of $12.75. How many miles did you travel
    14·1 answer
  • If Gloria gets violently ill a couple of hours after eating contaminated food, she will probably develop an aversion to the tast
    13·1 answer
  • Is the world safe place for animals and plants?<br><br><br><br><br>Guys pls answer it ​
    7·2 answers
  • Would there be any bacteria in an aquarium
    10·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • We say that DNA is complementary. This means that one side complements the other. Since we know the base-pairing rules..... if t
    15·1 answer
  • Which three elements are common to the reactants and the products of
    12·1 answer
  • Can we find living mitochondria in a dead cell?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!