1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
15

A direct care nurse performs exceedingly well on a cancer project. as a result, the managerial team decides to promote the nurse

to a managerial position. which actions by the nurse would justify the decision of the panel? select all that apply.
Biology
1 answer:
Masja [62]3 years ago
7 0
The following actions by the nurse would justify the decision of the panel:
1. MAXIMIZING RESULTS FROM EXISTING RESOURCES .
2. DEMONSTRATING POSITIVE FEELINGS.
3. ESTABLISHING SHORT TERM GOALS
4. INSPIRING NEW IDEAS.
The characteristics listed above qualified the nurse for holding a leadership role in her institutions. Been in a managerial position will also enable her to instill the same qualities in the nurses which are under her.
You might be interested in
Explain the structure of a chromosome (please)
Paha777 [63]

Answer:

Chromosome structure consists of a long arm region and a short arm region connected at a central region known as a centromere. The ends of a chromosome are called telomeres. Duplicated or replicated chromosomes have the familiar X-shape and are composed of identical sister chromatids.

Explanation:

7 0
3 years ago
What conclusion about the bacteria domain could be made from the phylogenetic tree below?
Elden [556K]

Answer: The correct answer is -

D. Eukarya has similar evolutionary traits to archaea.

A phylogenetic tree (also known as evolutionary tree) is a diagrammatic representation (in the form of branch diagram) showing the evolutionary relationships among various organisms. It is constructed on the basis of similarities or differences in the genetic or physical characteristics of various species.

In the given phylogenetic tree, archaea domain shows more similarities to the domain eukarya as it has descended after the domain bacteria.

Thus, option D) is the right answer.

5 0
3 years ago
The elements potassium (K) and chlorine (CI) can form an ionic bond. Which of the following
musickatia [10]

Answer:

As chlorine has 7 valence electrons, it tends to form bonds to gain one electron (to get a full valence shell of 8).On the other hand, potassium has one valence electron, so it tends to lose this electron to other atoms (and

become a cation)

8 0
3 years ago
To reveal trends in data the data should the data should be presented in an
MakcuM [25]
A graph. Graphs usually allow us to see trends or patterns in our data from experiments. Hope this helps :)
8 0
4 years ago
Read 2 more answers
What is the first checkpoint in the cell cycle where a cell will be causes to exit the cycle is this pooint is not passed?
Bess [88]
What is produced if a cell divides by mitosis but does not<span> undergo ... 24) Which is the </span>first checkpoint in the cell cycle where a cell will be caused to exit the cycle<span> if ... 28) Which of the following triggers the cell's passage </span>past<span> the G2 </span>checkpoint<span> ... they do so at random </span>points<span> in the cell </span>cycle<span>; they are </span>not<span>subject to cell </span>cycle<span> ...</span>
8 0
3 years ago
Other questions:
  • Identify the muscle labeled "11." gracilis semitendinosus gluteus medius biceps femoris adductor magnus
    15·1 answer
  • Normal urine has a specific gravity that is ________ than the specific gravity of pure water; dehydration leads to a __________
    12·1 answer
  • What does macromolecule mean? (Apex)
    9·1 answer
  • Do you think the wings of a Galapagos cormorant are vestigial structures?
    7·1 answer
  • For each picture shown, choose the level of organization depicted.
    7·2 answers
  • The lubber grasshopper is a very large grasshopper, and is black with red and yellow
    8·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is the name of the process shown?
    15·2 answers
  • QUESTION 16 Why does spoiled food become more sour? Spoilage microbes produce acid The nutrients in juice react with its packagi
    15·1 answer
  • When humans manipulate the genes of microorganisms the process is called.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!