1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
8

One potential benefit to using genetically modified foods is...

Biology
1 answer:
pychu [463]3 years ago
6 0
A. The improved yields of crop
You might be interested in
4. Explain the difference between a scientific law and a scientific theory.
madam [21]

Answer:

Scientific laws and theories have different jobs to do. A scientific law predicts the results of certain initial conditions. ... In contrast, a theory tries to provide the most logical explanation about why things happen as they do.

Explanation:

put this in ur own words its copied

4 0
2 years ago
The normal, or ________, eye accommodates properly.
zimovet [89]
The normal, or emmetropic, eye accommodates properly.
8 0
3 years ago
Where can the following organelle be found: Mitochondria. Also if it a multiple choice.
xxMikexx [17]

Answer:

all of them

Explanation:

Mitochondria are found in the cells of nearly every eukaryotic organism, including plants and animals. Cells that require a lot of energy, such as muscle cells, can contain hundreds or thousands of mitochondria.

BUT EACH CELL HAS A DEFINING TRAIT ABOUT THEM

-PROKARYOTIC-no nucleus

-PLANTS- cell wall. large central vacuole

-ANIMALS-multicellular might have more than one mitochondria

3 0
3 years ago
What is conservation...???
aleksandr82 [10.1K]
A short one. At least.
5 0
3 years ago
Viruses smaller than the host they infect
irina [24]
Viruses are much smaller then cells, viruses have genetic material DNA or RNA and cells also have genetic material
7 0
3 years ago
Other questions:
  • When atoms in a covalent bond share electrons unequally (one atoms pulls more than the other), the bond is said to be __________
    11·2 answers
  • If a polygons is an octagon then it has eight sides
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why are fences put along some beaches ?
    14·2 answers
  • Which of mendel's laws or principles states that gametes carry one allele for each trait?
    9·1 answer
  • What do phospholipids form a bilayer in water ?
    8·2 answers
  • Explain how it is that actin and myosin in the sarcomere never actually shorten and yet the muscle as a whole does.
    7·1 answer
  • Reasons for deforestation ?<br>​
    6·1 answer
  • What is the difference between heat<br> and temperature
    9·1 answer
  • Which of the following is true about an active site of an enzyme
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!