Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer : a mountain or a hill that is being created on the Earth's crust when magma lands on the surface.
A volcano is also referred to as the vent that facilitates the transport of molten rock from deepest part of the Earth towards the its surface. The magma or the molten rock that erupts from the volcano is called lava. Lava is responsible for the construction of the cone that surrounds the vent of the volcano. A volcano that erupts magma turned to lava is called and active volcano while the volcano that has not erupted for quite some time is called dormant volcano.
1. The Andes runs through the seven countries of <span>Venezuela, Ecuador, Colombia, Bolivia, Peru, Argentina and Chile.
2. Broad-leaf Evergreen forest is the most common type of vegetation in Latin America. Brazil has the most land with this type of vegetation.
3. Mexico City is the most populate city north of the equator. The three most populous cities south of the equator are </span><span>Buenos Aires, São Paulo, and Rio de Janeiro.
4. Oil is the most abundant resource in Latin America. Venezuela and Mexico have the most oil in Latin America.
5. This feature found here is </span><span>the Isthmus of Panama. It is in the country of Panama.
6. These three are </span><span>Suriname, the French Guiana, and Guyana.
:)
</span>
Strengths Perspective is not a practice use by social workers gain cultural competence in their practices with different groups.
<h3>What is Social workers?</h3>
Social workers refer to people who study social work as a disciple or profession which entails the study of people, individuals, families, groups, communities, and society as a whole in order to meet their basic needs and enhance social functioning, self-determination, collective responsibility, good health and their general wellbeing.
Therefore, Strengths Perspective is not a practice use by social workers to gain cultural competence in their practices with different groups.
Learn more about Social work from the link below.
brainly.com/question/13296433
