Answer:
Panama
Explanation:
"Panama is a country on the Isthmus of Panama, the landbridge between the Caribbean Sea and the Pacific Ocean, that links North and South America. It is bordered by Colombia and Costa Rica."
is about 55 miles at its narrowest point. so around 50 miles would be the answer.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
A human community with high population density and low economic status will have the highest birthrates.
Explanation:
A is not correct because usually, these are populations in countries that are transitioning from one political to another political model, and these populations actually tend to decline, mostly because of immigration.
B is not correct because such populations tend to have low birthrates, often even below the bar for simple replacement of the population.
C is not correct because such populations tend to live in very bad conditions, so despite having relatively high birthrates, they stagnate in their growth.
D is correct because such populations have both the numbers needed and also live in more traditional societies, leading to very high birthrates, as can be seen with Nigeria, Ethiopia, Pakistan, Indonesia, etc.
<u>Answer:</u>
Strict immigration laws did not influence the economic development of the United States.
<u>Explanation:
</u>
- Though the United States adopted strict immigration laws in order to filter the unwanted immigrants from flooding the country, many others who could comply with these laws moved to the United States and contributed to its growth and prosperity.
- The laws put up certain criterions that only allowed deserving people to flow in.
- Thus, strict immigration laws did not directly influence the functioning of the overall economy.
