1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zzz [600]
3 years ago
9

What is the object of mitosis? What mechanism in mitosis allow this to occur?

Biology
1 answer:
Charra [1.4K]3 years ago
5 0
To produce two diploid daughter cells that are identical to each other
You might be interested in
Upon examination, an unknown plant is found to have vascular tissue, spores, and large fronds. Which of the following is the mos
Elza [17]
<span>
It is a fern and belongs to Phylum Pterophyta

Fern is a plant with fronds that are attached to rhizomes. The frond is the leaf of the fern and the rhizome is the root which grows. They have vascular tissue which means that they use tubular structures to transport nutrients throughout the plant. They reproduce by spores and have neither seeds nor flowers.

</span>
7 0
3 years ago
Read 2 more answers
How would the bacteria most likely respond to survive
mezya [45]

Answer:

the respmifuv fded

'v;ebn\

]'fd[v';mlgre ,.al';pk]jinbl k,efmdv;lsk[ojibk n,m./';lpkojc nlkoivhubkn ,mkdfcdf ncx kbjcx

Explanation:

5 0
3 years ago
Wind erosion can be reduced by ___.
Zepler [3.9K]

Answer is - planting trees!

4 0
3 years ago
Read 2 more answers
Cells responsible for histamine release
ladessa [460]

Answer:

Mast Cells

Explanation:

Mast cells release histamine in the blood stream, when they detect a substance that triggers an allergic reaction, also called an allergen.

3 0
3 years ago
What part of a plant cell has the function of producing sugar in the presence of sunlight??
il63 [147K]
It's the <span>chloroplast.

Hope this helps !

Photon</span>
6 0
4 years ago
Read 2 more answers
Other questions:
  • A recessive gene located on the X chromosome is the cause of hemophilia in affected individuals. Males are more likely to have h
    12·1 answer
  • Please help me with the ones that are empty!!
    8·1 answer
  • Which element is found in nucleic acids but not in amino acids? carbon hydrogen nitrogen phosphorus
    5·2 answers
  • Why is ""Climate Change"" a more accurate description of the increase in Earth’s temperature than ""Global Warming""? A. it is u
    15·1 answer
  • A terrestrial animal species is discovered with the following larval characteristics: exoskeleton, system of tubes for gas excha
    7·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How does the sun release energy
    14·2 answers
  • What are the waste by products of this form of resource energy ?
    7·1 answer
  • What percent of the DNA produced during replication is new?
    6·2 answers
  • Xxkddkkdjxjxjzxjxzsdkdciscjdcjddj
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!