1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Assoli18 [71]
4 years ago
14

The diagram represents one of Mendel’s laws or principles of inheritance.

Biology
1 answer:
Levart [38]4 years ago
6 0
The law of segregation must be answer
You might be interested in
Why is it important that a plant's phloem extends into its leaves?
Cerrena [4.2K]
The correct answer among the choices listed above is option C. It is important that a plant's phloem extends into its leaves because the phloem <span>collects the sugars made during photosynthesis and carries them around the plant. Hope this answers the question.</span>
7 0
3 years ago
Read 2 more answers
Which of the following would be the LEAST likely to be associated with the development of motion sickness? driving rapidly over
Setler79 [48]

Answer: Having a non-functional vestibular apparatus.

Explanation:

Motion sickness is a feeling of sickness that is caused by the movement. It occurs in a vehicle like boat, car, train or bus. It can also occur in the amusement rides. This is not life-threatening. It can make the ride or traveling unpleasant. Motion sickness happens when the brain receives the disturbing message related to the motion and the body's position. These messages are delivered from the ear, eyes, skin receptor, muscles and the joints sensors.

Among the options given, Having a non-functional vestibular apparatus. is not the associated with the development of motion sickness. The vestibular apparatus is associated with ear if the ear sensory system becomes non-functional then it will reduce the sensing of motion sickness.

5 0
4 years ago
How do the benefits of natural change to ecosystems compare to the disadvantages? a. The benefits are outweighed by the disadvan
tensa zangetsu [6.8K]
Well new species can come and live there and some animals may have new food but the disadvantage is some of the animals ill die that lived there because of the changes...i hope this helped you
8 0
4 years ago
Read 2 more answers
A bird's ability to fly south then winder weather approaches is an example what<br><br> adaptation?
BigorU [14]
Yes it’s is adaptation
7 0
3 years ago
What factors must the nurse consider as part of core drug knowledge when administering a medication to a pediatric client rather
zvonat [6]
<span>Here are some of the factors that a nurse should consider when administering a medication to a pediatric client verses and adult client. As part of core drug knowledge the nurse should consider age, weight, height also previous and current medical conditions.</span>
3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why is a toxic chemical spill on land potentially harmful to animals that live in the ocean?
    8·2 answers
  • What is transport sugar
    7·1 answer
  • What is the purpose of Mitosis In single-celled organisms
    8·1 answer
  • Why does the amount of daylight we see each day change throughout the year?
    14·2 answers
  • Does cell city represent a plant cell or an animal cell? Explain your answer
    7·1 answer
  • Describe at least three ways to ensure the accuracy of abiotic data.
    12·1 answer
  • Which of the following is an example of the endocrine System maintaining homeostasis?
    6·2 answers
  • Carbonate sediments are rare in deep sea sediments because the ____. a. organisms do not live beyond the edge of the continental
    5·1 answer
  • In general what causes a sea breeze
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!