1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
3 years ago
15

Last question!!

Biology
2 answers:
Pepsi [2]3 years ago
6 0

Answer:

A sex chromosome is the answer

muminat3 years ago
6 0

Answer:

A(n) sex chromosome is the product of gametes from two different sources.

You might be interested in
Explain Mendel's law of segregation and how it predicts the 3:1 dominant-to-recessive phenotypic ratio among the F2 generation o
Olenka [21]

Answer:

Mendel is known as the father of genetics. He explained the law of segregation by the monohybrid cross. The monohybrid cross involves the cross of a single trait at a time.

Law of segregation explains that at the time of formation of gametes, the allele pairs get separated from the pairs of trait. The concept of dominance was also explained. The traits that express itself even in the heterozygous condition is known as dominant trait (T). The trait that can not express itself is known as recessive trait (t).

For example:

Parents TT        ×       tt.   (Laws of segregation)

Gamete   T                  t

F1 generation  Tt.

Selfing of F1 generation

Tt       ×        Tt

Offspring :   TT (tall) , Tt (tall) , Tt (tall) , tt (dwarf).

The phenotypic ratio is tall : dwarf (3 : 1)

4 0
3 years ago
Lactase is an enzyme that many different animals have that helps digest the sugar lactose Why can this enzyme be the same in dif
Agata [3.3K]

Answer:

All living things share a common code-DNA

Explanation:

Enzymes are proteinous substances, which like every other proteins are encoded by a genes. In the expression of these genes, a set of codons (three nucleotide base) called GENETIC CODE is used. ONE of the characteristics of this genetic code is that it is NEARLY UNIVERSAL meaning that the same genetic code is used by virtually all known living organism.

According to this question, lactase enzyme, which helps digest lactose sugar in organisms, is the same in different organisms. This is due to the fact that all living things share a common code-DNA e.g AUG codes for methionine in all organisms, hence, when these DNA undergoes expression, it yields the same products in different organisms.

5 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
Witch artists used these two methods to make pottery:the coil method and the potters wheel? A. minoan B.aztec C. anasazi D.chine
pshichka [43]

Answer:

I'm pretty sure the answer is d

Explanation:

8 0
3 years ago
Read 2 more answers
Mountains are usually formed by: movement of the earth's crust volcanic explosions placement of eroded land weathering away of l
BARSIC [14]

Answer:

it might be movement of the earths crust

Explanation:

5 0
4 years ago
Other questions:
  • For which one of the following observations were both Lamarck's hypothesis and Darwin's hypothesis in complete agreement? a. Acq
    11·2 answers
  • On a summer camping on the coast trip, Maria and her family hunted for sharks teeth. Sharks teeth are fossilized remains of anci
    6·2 answers
  • What organism is able to appear at any level in a food chain/web?why?
    10·1 answer
  • What is the function of tomato in the preparation of swiss steak?
    9·1 answer
  • Why does sexual reproduction produce offspring with characteristics that are different from their parents, where as offsprings p
    7·1 answer
  • What substance is the most acidic. lemon juice. tomato juice. sodium hydroxide. water
    8·1 answer
  • Long term exposure to ___________ waves can cause sunburns and skin cancer.
    14·2 answers
  • What are three terms used to describe organisms such as lions?
    9·2 answers
  • Water molecules have oppositely charged ends, + and -
    9·1 answer
  • 1) What did you notice about the letter e when you increased in magnification from the 4x to the 10x and then to the 40x:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!