1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
3 years ago
9

Characteristics common to plants and animals regarding growth and reproduction are ______. (can be more than one answer)

Biology
2 answers:
Alina [70]3 years ago
8 0

Answer:

The correct answer will be-cells, DNA,  genes

Explanation:

Both plants and animals are living organism which is made up of the smallest unit of life called cells.

Both plants and animals have the ability to grow and reproduce which require genes on DNA which gets passed on to the progenies. For growth and reproduction, both have to undergo cell division which leads to the increase in number as well size of the organism.

Thus, the selected option is the correct answer.

lidiya [134]3 years ago
3 0

evolution, and interdependence.

You might be interested in
The alleles that control which blood group antigens appear on the surfaces of red blood cells are:
evablogger [386]
<span>the alleles that control which blood group antigens appear on the suface of red blood cells are codominant.</span>
8 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Kiran lit a candle she placed a 100cm (cubed) glass jar over the candle. The candle flame went out after 2 seconds. Why did the
larisa86 [58]
The flame cannot be in a cubed jar long it has to be in a cylinder in order for the flame to stay lit. I hope this helps!
6 0
3 years ago
Plants use CO2 in the process of photosynthesis to make
igomit [66]

Answer:

food for less than a year ago today was a good day for you drink a lot of water and summer vacation visiting with you drink a lot of water and summer vacation visiting with you and your name and address in a bit in me in me in me in

5 0
2 years ago
Read 2 more answers
What part of a gene has the nonfunctional code? 100 points please
harkovskaia [24]

The answer is Introns.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which relationship best demonstrates cooperation between species?
    15·2 answers
  • Is the elliptical shape of the earths orbit changes all the time
    6·1 answer
  • People living in and around the Amazon rain forest
    8·1 answer
  • According to the Lab Safety Sheet provided for this week, which of the following is a potential hazard you will face in the b-ga
    15·1 answer
  • The most productive marine habitats are in the open ocean.<br><br> true or false?
    11·2 answers
  • In eukaryotic cells, the timing of the cell is regulated by?
    6·1 answer
  • H
    6·1 answer
  • How do cells communicate in the body
    11·1 answer
  • Mutations within a DNA sequence are
    8·1 answer
  • Mutations can occur in the chromosomes of all types of cells. Mutations that are passed to offspring must occur in _____
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!