1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
2 years ago
10

Which species interaction applies to bees that harvest nectar and pollen from flowers?

Biology
1 answer:
Elden [556K]2 years ago
4 0
They are a very good example of mutualism in which each species benefits.  Please mark Brainliest!!!
You might be interested in
SIMPLE QUESTION <br><br> what do sage brush eat?
LenKa [72]
The sagebrush eats insects. When the insects land o the inside of the of the plant. the plant closes its mouth trapping the insects inside.  
5 0
2 years ago
Read 2 more answers
Options: dna, nucleus, cytoplasm, cell membrane, ribosomes
Finger [1]

Answer:

Sorry if I get it wrong but I think

A: Nucleus

B: Cytoplasm

C:Ribosomes

D:DNA

E:Cell membrain

Explanation:

6 0
3 years ago
Jupiter, Saturn, Uranus, and Neptune are made up by what gases?
Svetlanka [38]

Answer:

hydrogen and helium

Explanation:

Jupiter, Saturn, Uranus, and Neptune are made up hydrogen and helium gases and called gas giants of solar system.

Uranus and Neptune also consist of more ices and methane in comparison to  Jupiter and Saturn.

Jupiter is the largest planet in the solar system and also have rings around it consist of rocks.

Hence, the correct answer is hydrogen and helium.

8 0
3 years ago
What are the positive and negative aspects of a zoo or safari park?
timama [110]
Positive: You get to see different animals, see all kinds of habitats, learn new facts about all the animals and see them maybe in action! 

Negative: They might be sleeping, In a cage or fence so they can't get out, restricted. 
5 0
2 years ago
Read 2 more answers
What is the main purpose of the digestive system
DENIUS [597]

Answer:

to digest the food

Explanation:

The main purpose of the digestive is to get the nutrients out of the food that you eat. When you eat something, it goes through the digestive system to get the fuel and nutrients from the food that you eat.

6 0
2 years ago
Other questions:
  • Increased pressure in the ventricles would close what valve(s)?
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • If an object is less dense that the liquid it is placed into, what will happen?
    7·1 answer
  • What are the two major parts of photosynthesis and why is this process important to the ocean?
    11·1 answer
  • Describe continental drift and plate tectonics. How can these affect the evolution of different plant and animal species?
    14·1 answer
  • Which is part of the theory of evolution by natural selection?
    9·2 answers
  • Regulating the manufacture of<br> is the function of RNA.<br> protein<br> cells<br> energy
    15·2 answers
  • Which traits make fungi more related to animals than to plants? (4 points)
    7·1 answer
  • Describe the terms chromosomes, genes, alleles, and DNA in relation to heredity and to each other.
    10·1 answer
  • HIV attack of CD4 T cells causes suppression of both cell-mediated and humoral immune responses. Group of answer choices True Fa
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!