Answer:
The Financial Crisis Inquiry Commission was created to “examine the causes of the
current financial and economic crisis in the United States.” In this report, the Commission presents to the President, the Congress, and the American people the results
of its examination and its conclusions as to the causes of the crisis.
More than two years after the worst of the financial crisis, our economy, as well as
communities and families across the country, continues to experience the aftershocks. Millions of Americans have lost their jobs and their homes, and the economy
is still struggling to rebound. This report is intended to provide a historical accounting of what brought our financial system and economy to a precipice and to help policy makers and the public better understand how this calamity came to be
Explanation:i would do more sorry if it wasnt only 200
<span>The answer to this question is COAL. Coal is used
as a solid fossil fuel that people used the most. Coals are used for
electricity, fuel, and heat. Coals that are mined are brought to power plants
to use it as electricity. Coals are being mined from the ground and the country
China is the world’s top coal producer since 1983.</span>
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
A
Explanation:
Asthe other statments are false, and contain information which is wrong
In honey, with a picture, and a cyro solution.
Hope this helps!
