1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
4 years ago
10

Two types of dry climates

Geography
2 answers:
ivanzaharov [21]4 years ago
6 0
Any desert. "Sahara and arctic" Deserts are classified according to their lack or precipitation. Hope this helps.

ddd [48]4 years ago
3 0
Arid<span> and semiarid is the two dry climates

</span>
You might be interested in
The pen is lying on table.the pen is your.into one sentence joining with which/that​
nikitadnepr [17]

Answer:

the pen which is laying on the table that is yours?

3 0
3 years ago
Read 2 more answers
What is the academic definition of weather?
Nady [450]

Answer: Weather is the state of the atmosphere in a specific time and place

Explanation:

.

7 0
4 years ago
What is the difference between the cultures of Central Asia and the Caucasus region?
zhannawk [14.2K]

A. hope this helps!

Have a nice day

4 0
4 years ago
Read 2 more answers
What are the names of 3 countries that the equator runs through?
Artist 52 [7]

Answer:

Ecuador, Colombia, Brazil, Sao Tome & Principe, Gabon, Republic of the Congo, Democratic Republic of the Congo, Uganda, Kenya, Somalia, Maldives, Indonesia and Kiribati

Explanation:

These are 13 countries the equator runs through

8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What was called the dark continent?
    7·1 answer
  • The typical subjects for traditional African sculpture include _____.
    5·2 answers
  • Que hemisferio del ecuador presenta mayor porcentaje de tierras continentales y/o emergidas
    15·1 answer
  • We have direct experimental evidence (from large particle accelerators) for the physical conditions in the universe back to abou
    10·1 answer
  • How is the earth's crust under the oceans different from the crust below the continents?
    8·2 answers
  • Which term describes news that focuses more on individual interests and the needs of its consumers?
    14·1 answer
  • What role do cottage industries play in India's economy?
    6·1 answer
  • For this assignment, you will research and create a map and a three-dimensional model of a specific landform found on Earth. Aft
    8·1 answer
  • What is environmental conservation?
    5·2 answers
  • When did Singapore’s big trash problem begin ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!