When you look at the Sun through a filtered telescope, you notice a blotchy appearance.

Biology

2 answers:

lyudmila [28]3 years ago

8 0

Answer:

The part of the Sun that you are observing when you see a blotchy appearance is the surface of the sun. This appearance is called granulation which is caused by the convection of the hot material inside the sun which go up and down the surface of the sun. Because of its sandy texture it is sometimes called lemon peel or rice grain.

Explanation:

e-lub [12.9K]3 years ago

3 0

You might be interested in

This is one of the processes by which ATP is synthesized. In eukaryotes, it takes place in the mitochondria during cellular resp

marissa [1.9K]

Answer:

answer you looking for is i think Phosphorylation.

Explanation:

please ask the question more meaningfully

7 0

3 years ago

What are the first organisms to inhabit the corpse?

Valentin [98]

Bacteria is the first organism to inhabit a corpse.

8 0

3 years ago

What kind of nucleic acid is found in retroviruses?

yKpoI14uk [10]

Answer:

A retrovirus is an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host's genome by an integrase enzyme. The virus thereafter replicates as part of the host cell's DNA.

7 0

3 years ago

Why are theories accepted as true?

lesya692 [45]

They are accepted as true until they are proven false. Once a theory has been tested and it is wrong, then it is no longer true.

4 0

3 years ago

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

5 0

3 years ago