1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anastassius [24]
4 years ago
15

Name some means of transport you know?​

Geography
1 answer:
Murrr4er [49]4 years ago
5 0
Bus, trains, cars, commercial flying, private jet, boat
You might be interested in
What doee an enzyme do to the activation energy necessary to start a chemical teeaction
OlgaM077 [116]
Catalysts lower the activation energy for reactions. The lower the activation energy for a reaction, the faster the rate. Thus enzymes speed up reactions by lowering activation energy. ... The binding of a substrate to an enzyme active site is termed the "enzyme-substrate complex.
6 0
4 years ago
Parallels and meridians are one in the same true or false
sveticcg [70]
I think it's false. I may be wrong. Sorry if i am
4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Give me Questions about NGO (non-governmental organization)
Monica [59]

Answer:

ok

Explanation:

Does the NGO support the long- term vision and strategy of the company?

Will it engage and inspire employees at all levels ?

hope this helps

7 0
3 years ago
Is the speed of sound the same at all depths? Explain
Soloha48 [4]
No.

The speed of sound in water depends on the temperature and pressure. As you go deeper, the pressure increases and the speed of sound increases.
7 0
3 years ago
Other questions:
  • What was taken from the dragon that awoke him
    10·1 answer
  • Probably the main reason africans, rather than native americans, became slaves in america was that
    12·1 answer
  • What caused the Great Rift Valley and the Great Escarpment?
    14·2 answers
  • Which graph shows a proportional relationship?<br><br> graph A<br> graph B<br> graph C<br> graph D
    8·2 answers
  • Volcanic ash and sulfur dioxide spewed out of Mt. Pinatubo in 1991. These materials can reflect incoming solar radiation. Over t
    14·2 answers
  • Where does a penguin live
    5·2 answers
  • As the glaciers in North America melted, the runoff formed a large lake in what is now southern Manitoba, eastern North Dakota,
    10·1 answer
  • A. How do events like deforestation, diversion of water from rivers, climate change, etc., in the Amazon rainforest impact the w
    8·1 answer
  • Please Please help thank you <br><br><br>how the CARES Act is supposed to support the economy?
    10·1 answer
  • Which is a drawback of both air conditioning and desalinization?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!