1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
3 years ago
12

The function of pulmonary ventilation is to ___________.

Biology
1 answer:
lara31 [8.8K]3 years ago
8 0

Answer:

The function of pulmonary ventilation is to b. maintain adequate alveolar ventilation.

Explanation:

<em>Pulmonary ventilation refers to the movement of air into and out of the lungs, so its main function is to maintain adequate alveolar ventilation.</em> The air moves out of the lungs when the pressure inside the lungs is greater than the pressure in the atmosphere. In the lungs, Inside the air sacs, oxygen moves across paper-thin walls to tiny blood vessels called capillaries and into your blood. That's how the oxygen gets into the bloodstream.

You might be interested in
Which of the following is a feature of all cells
morpeh [17]

<em>All cells have these four parts in common: a plasma membrane, cytoplasm, ribosomes, and DNA. But the main common feature that is most talked about it Cytoplasm and Ribosomes. Cytoplasm, the rest of the material of the cell within the plasma membrane, excluding the nucleoid region or nucleus, that consists of a fluid portion called the cytosol and the organelles and other particles suspended in it. Ribosomes, the organelles on which protein synthesis takes place.</em>

Hope this helps, have a good day. c;

8 0
3 years ago
Read 2 more answers
Which statement describes the structure of lipids?
iren2701 [21]

Answer:

composed of a glycerol molecule binded to fatty acid molecules

Explanation:

6 0
3 years ago
What are 2 nutrients that cause eutrophication
agasfer [191]
Nitrogen and phosphorus?
4 0
4 years ago
Which statements best describe shared characteristics? Check all that apply.
Masteriza [31]

a~ shared characteristics are features or qualities that organisms or species have in common.

c~ shared characteristics can be characteristics that existed in the common ancestor and still exist in modern organisms.

d~ shared characteristics can be new characteristics that have been modified from what was found in the common ancestor.

i hope these are correct, if they aren't, i'm so sorry.

btw, i love your username!!

rose from blackpink? Imaoo :D~

3 0
3 years ago
Read 2 more answers
Embryology provides evidence for evolution because
inysia [295]

Answer:

C

Explanation:

During their development, many organisms look similar, suggesting that very different organisms may have a common ancestor. - Think of the human fetal neural / spine development which mirrors other species.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Like all forms of life on earth, all microbial cells perform three major types of activities:
    8·1 answer
  • What is a period with lower-than-average precipitation?
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the input of the light-dependent reactions, labeled X?
    5·1 answer
  • The heart is considered a/an _______ and the cardiac muscle that includes it is considered _______
    13·1 answer
  • What is the difference between choroid and sclera
    12·1 answer
  • Differentiate between inorganic and organic nitrogenous compounds with examples.
    5·2 answers
  • Which of the following statements is/are true with regard to a polymer of 6 glucose molecules?
    15·1 answer
  • Bacteria are important in sewage disposal because they _____. A. Neutralize Sewage B. from Vacuoles In Sewage C. Digest Sewage D
    9·2 answers
  • How a forest ecosystem would change if no sunlight were available to it
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!