1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
2 years ago
5

Who developed the two-part naming system scientists use today to classify newly found organisms?

Biology
1 answer:
Artist 52 [7]2 years ago
4 0
Carl Linnaeus- developed the two-part naming system scientists use today to classify newly found organisms
You might be interested in
Why yeast cells cannot produce glucose
Ganezh [65]
 This is what I found on the internet: Ethanol The alcohol which is produced<span> as a result of fermentation of sugars by </span>yeast<span>. fermentation A term for respiration in the absence of oxygen. </span>glucose<span> A simple sugar made by the body from food, which is used by </span>cells<span> to make energy in respiration. lactic acid A toxic chemical </span>produced<span> during anaerobic respiration.</span>
7 0
3 years ago
Read 2 more answers
Put the sequence of protein synthesis in the proper order: amino acids bind to each other, the chain lengthens mrna copies dna a
algol13

Answer:

There is no question to this text.

Explanation:

6 0
2 years ago
A stimulus triggers the body to create a response that feeds back to reverse the changes caused by the original stimulus. What i
Amiraneli [1.4K]
A stimulus triggers the body to create a response that feeds back to reverse the changes caused by the original stimulus,the whole process is known as n<span>egative feedback loop.Mark Me Brainlest Please</span>
5 0
3 years ago
Read 2 more answers
Two mice breed. The male is heterozygous for the dominant traits of black fur and active behavior but is homozygous recessive fo
olya-2409 [2.1K]

Answer:

Four

Explanation:

Let the allele for black fur be B (the alternate will be b), the allele for active behavior be A (the alternate will be a), and the allele for light eyes be L (the alternate will be l).

<em>Heterozygous dominant for black fur = Bb</em>

<em>Heterozygous dominant for active behavior = Aa</em>

<em>Homozygous recessive for light eyes = ll</em>

Hence, the genotype for a male that is heterozygous for the dominant traits of black fur and active behavior but is homozygous recessive for light eyes will be BbAall.

Bb   Aa   ll

Possible Gametes

<em>BAl, Bal, bAl, and bal</em>

Therefore, the number of different types of gametes produced by the male mouse is four.

5 0
3 years ago
Describe the flow of energy from a glucose molecule to ATP during respiration, and compare this to the flow of energy from gluco
svlad2 [7]

Answer:

Glycolysis is the first step of the cellular respiration in an organism which is metabolic pathway that is completed in the cytosol of the cell that leads to the converting glucose to the pyruvate in order to produce energy in form of ATP:

1. Glucose-6-phosphate is ---> fructose-6-phosphate

2. fructose-6-phosphate ---> fructose-1,6-biphosphate

3. fructose-1,6-biphosphate ---> glyceraldehyde-3-phosphate(GAP) and dihydroxyacetone phosphate (DHAP).

4. GAP is oxidised ----> 3-bisphosphoglycerate + NADH

5.  3-bisphosphoglycerate  ----> 1,3-bisphophoglycerat

6. 1,3-bisphophoglycerate   ----> 3-phosphoglycerate

7. 3-phosphoglycerate ----> 2-phosphoglycerate

8.  2-phosphoglycerate  ----> phosphoenolpyruvate (PEP)

9. phosphoenolpyruvate to ADP  ----> pyruvic acid + ATP

Formation of ATP occurs in both pathways or process that are respiration and fermentation. Fermentation is a catabolic pathway leads to the degradation of sugars (partial) that result in the gain of energy and this energy are absorbed in ATP.  There are difference of the amount of energy or ATP produce in these process in respiration 38 ATP are produced whereas during fermentation only 2 ATP are produced.

4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • When ATP is used in the cell it becomes ___
    5·1 answer
  • These lumps of ice can be as big as baseballs.
    13·1 answer
  • If spiders cann't chew how do they eat
    7·1 answer
  • Remoras are small fish that attach themselves to the sides of sharks. They get protection and scraps of food from the shark. The
    10·1 answer
  • Explain the two ways of estimating the ages of rocks and fossils
    14·1 answer
  • Having the gene for a protein and making a protein leads to having a trait for organisms.
    10·1 answer
  • True or False: Two genes on the same chromosome may become separated during meiosis.​
    6·1 answer
  • A student creates a model of a calendar to show the phases of the Moon in January.
    15·1 answer
  • A good scientifific blank can be repeated by someone else and the same results will be found
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!