Answer:
It is also one of the world's most important commercial waterways and one of North America's great migration routes for both birds and fishes. Native Americans lived along its banks and used the river for sustenance and transportation.
Explanation:
Answer:
What caused Galetown to have more severe rainstorms? The lake, warmer weather, and stronger winds all caused the most recent storm to have the greatest amount of rain. The addition of the lake caused there to be more water available to evaporate into water vapor in the air parcel
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Temperature changes can also contribute to mechanical weathering in a process called thermal stress. Changes in temperature cause rock to expand (with heat) and contract (with cold). As this happens over and over again, the structure of the rock weakens.
Explanation:
Immature seed cones of conifers are usually green before pollination, and flowers of grasses are inconspicuously colored. What does this indicate about their pollination? they are wind pollinated.
