1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksAgata [21]
4 years ago
12

What kind of energy cooks our food?

Biology
2 answers:
Cloud [144]4 years ago
7 0
Thermal Energy is transferred to food in conduction, convection, or radiation
7nadin3 [17]4 years ago
5 0
Thermal energy is used to cook food. Thermal energy is heat. It's converted from either electrical potential energy or chemical potential energy depending on the cooking appliance. An electric stove converts electric potential energy to thermal energy.
You might be interested in
How is the mississippi river Important to the US development
mihalych1998 [28]

Answer:

It is also one of the world's most important commercial waterways and one of North America's great migration routes for both birds and fishes. Native Americans lived along its banks and used the river for sustenance and transportation.

Explanation:

3 0
3 years ago
Why did the most recent storm in<br> Galetown have the greatest amount of<br> rain?
grandymaker [24]

Answer:

What caused Galetown to have more severe rainstorms? The lake, warmer weather, and stronger winds all caused the most recent storm to have the greatest amount of rain. The addition of the lake caused there to be more water available to evaporate into water vapor in the air parcel

5 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
What is one way that temperature affects mechanical weathering?
Ket [755]

Answer:

Temperature changes can also contribute to mechanical weathering in a process called thermal stress. Changes in temperature cause rock to expand (with heat) and contract (with cold). As this happens over and over again, the structure of the rock weakens.

Explanation:

3 0
3 years ago
Immature seed cones of conifers are usually green before pollination, and flowers of grasses are inconspicuously colored. What d
otez555 [7]
Immature seed cones of conifers are usually green before pollination, and flowers of grasses are inconspicuously colored. What does this indicate about their pollination? they are wind pollinated.
6 0
2 years ago
Other questions:
  • Which term correctly identifies this part of a dermal (skin) cell?
    14·2 answers
  • 2.During which phase does the cell actually separate into two individual daughter cells?
    6·2 answers
  • What is the scientific name of a giraffe using
    12·2 answers
  • The interconnection of living things is known as ____.​
    9·1 answer
  • Which two cells pass on information from parents to children?
    14·1 answer
  • Question 2
    6·2 answers
  • Explain what it means to describe a water molecule as “polar “
    8·2 answers
  • Describe the concept of natural selection, using the Galapagos finches as an example. Imagine you were trying to explain the con
    10·1 answer
  • QUESTION 6<br> What do red blood cells do?
    12·2 answers
  • Explain the concept of “survival of the fittest.”
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!