Diffusion and osmosis to get the minerals in and the pholem uses diffusion to transport all parts of the plant body
To conduct water and minerals to the leaves
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
it has a DNA chromosome coz the dna molecule is packaged in to thread like structures called chromosomes..each chromosome is made up of dna tightly coiled many times around proteins called histons dat support its stracture
