1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
4 years ago
6

I believe the answer is "B". Please correct me.

Biology
1 answer:
sladkih [1.3K]4 years ago
4 0

Answer:

A

Explanation:

A because water needs to be evaporated first

tbh I'm torn between a and b

You might be interested in
Please help I have no idea the awnser
Colt1911 [192]

Answer:

yes u should always view your notes

4 0
2 years ago
How do nutrients get to the cells in a flatworms solid acoelomate body?
wariber [46]
The nutrients get to the cells in a flatworms solid acoelomate body by diffusion process. Flatworms feed primarily on protozoa and bacteria, smaller worms and tiny organisms, dead or alive, that they come across. Based on the species of the flatworms , they also consume plant materials. They rely on diffusion to transport oxygen and nutrients to their internal tissues.
8 0
3 years ago
On-site soil quality and crop productivity?
Vinvika [58]

Healthy soils produce healthy crops that in turn nourish people and animals.  Soils supply the essential nutrients, water, oxygen and root support that our food-producing plants need to grow and flourish. They also serve as a buffer to protect delicate plant roots from drastic fluctuations in temperature.

4 0
3 years ago
Which of the following represents the damaging effects of deforestation
solmaris [256]

Answer:

It can be characterized by the extreme heat or too much rainfall. Deforestation also degrades soil quality and is a major cause of the world's rapid desertification. Such weather patterns and environmental changes contribute to the plummeting of the agricultural production.

Explanation:

7 0
3 years ago
Read 2 more answers
A person has trouble coordinating muscle movements. Which two tissues could be injured?
Basile [38]

Answer:

connective; epithelial

Explanation:

3 0
3 years ago
Other questions:
  • What is the difference between a cladogram and a phylogenetic tree
    5·1 answer
  • What do intensity maps do and why are they important
    10·1 answer
  • What is the weight, on Earth, of a book with a mass of 1.5 kg? 1.5 N 6.5 N 11.3 N 14.7 N
    11·2 answers
  • All chordates live in the ocean. True or false
    6·1 answer
  • What is the relationship between the bud and the parent
    14·2 answers
  • Describe the steps that bone goes through as it heals from a break.
    14·1 answer
  • The occurrence of a chance event during one trial does not influence the results of later trials. This is an important principle
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which is an advantage of using nuclear energy as a power source?
    6·1 answer
  • An avid reptile collector, Julia wants to add a monitor lizard to her family of reptiles. She has done some research on how to c
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!