1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timama [110]
3 years ago
13

What role does nucleus play in dna replication?

Biology
1 answer:
Tanzania [10]3 years ago
4 0
The nucleus is the control center of the cell.
You might be interested in
Adult giraffes eat about 75 pounds of food in a day. On average, an area can provide 450 pounds of food per day for giraffes. Ba
densk [106]

Answer:

6 giraffes

Explanation:

If an area can provide 450 pounds of food for the giraffes and the giraffes eat 75 pounds of food per day, you can divide:

450 by 75= 6

6 giraffes is the capacity for that area

4 0
3 years ago
Read 2 more answers
Studying the folding patterns of protein molecules can help microbiologists better understand cellular processes as well as some
vivado [14]
The statement that best describes the work of these researchers is "As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done." I hope my answer has come to your help. God bless and have a nice day ahead!
5 0
3 years ago
Please Help I Don't Understand
Aneli [31]

<em><u>ANSWER:</u></em><em><u> </u></em>

<em><u>The </u></em><em><u>ans </u></em><em><u>is </u></em><em><u>true!</u></em>

4 0
1 year ago
Read 2 more answers
What was the name of a wealthy Saudi who quickly rose to leadership<br> within the mujahideen?
scoray [572]
Uring this period he became acquainted with Osama bin Laden, a wealthy Saudi who had joined the Afghan resistance to the Soviets,
4 0
1 year ago
Abiotic factors in the environment are all _________. A. Easily measured B. Living C. The same as the dead things D. Non living
Ede4ka [16]

Answer:

the answer is d. non living

8 0
3 years ago
Other questions:
  • Which of the following scenarios represents the best use of a scientific model?
    11·2 answers
  • What are the threadlike structures that make up the body of multicellular fungi called?
    6·1 answer
  • Evolutionary advancement of arthropods over platyhelminthes
    5·1 answer
  • In general, the ______ system reacts more quickly than the endocrine system to maintain homeostasis.
    11·1 answer
  • If a DNA molecule is compared to a spiral staircase what parts makes up the steps
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Please Please Please Help Me With This Science Sheet!!!!!!!
    11·1 answer
  • Describe the unique anatomical features of cardiac muscle. What role does the unique structure of cardiac muscle play in its fun
    7·1 answer
  • ribozymes are rna molecules that have enzymatic activity. this conflicts with the belief of early molecular biologists that
    15·1 answer
  • Which enzymes are secreted only by the pancreas
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!