1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
3 years ago
13

Select the definition of aneuploidy.

Biology
1 answer:
Kobotan [32]3 years ago
4 0

Answer:

d. The addition or loss of less than a full set of chromosomes or chromosome pairs is the correct answer.

Explanation:

  • Aneuploidy is an abnormal condition because the number of chromosomes is not normal.
  • This condition occurs due to the presence of extra chromosomes or loss of chromosomes that unbalance the chromosome number.
  • Aneuploidy can cause miscarriage, birth problems, alter the fetus development.
  • Different disorders arise from the aneuploidy condition such as turner's syndrome, Klinefelter syndrome,trisomy,Edwards syndrome,Patau syndrome.

You might be interested in
Plate movements help drive the rock cycle by helping to form ________the source of igneous rocks
Gekata [30.6K]
Magma



Good luck!!!!!! (:
5 0
3 years ago
Read 2 more answers
Can someone please help me? photo attached.
IceJOKER [234]

Answer:

3 cm is the

Explanation:

3 cm is the jjj you wanna be friends

8 0
3 years ago
Read 2 more answers
What is nitrugen cycle?<br>​
stealth61 [152]

Answer:

A repeating process where nitrogen moves through living and non living things like the atmosphere, soil, water, plants, and animals. Nitrogen must change forms in order to go through its cycle.

Explanation:

7 0
3 years ago
Motor units that involve Type II fibers are typically activated via...
Zigmanuir [339]
Larger slow conducting neurons
8 0
3 years ago
Glucose is not our only food source, nor the only one we can utilize in our bodies to generate energy. other primary sources of
notsponge [240]
They're converted to 'Acetyl- CoA' 

Hope this helps
8 0
4 years ago
Other questions:
  • The native structure of hemoglobin (hb) comprises of two α and two β subunits, each of which carries a heme group. there appear
    8·2 answers
  • What does CO2 do to heat in the atmosphere
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Write a sentence to relate the terms natural selection and speciation.
    8·1 answer
  • If a substance weighs 2.00 grams and you need the mass in kilograms, will the number appear to become smaller or larger?
    11·1 answer
  • The graphic shows a a six-kingdom model published by Thomas Cavalier-Smith in 1998, which has since been revised to a seven king
    7·1 answer
  • What is the least diverse (fewest number) group of living things found in Pennslyvania
    7·2 answers
  • Which of the following is NOT true of a physical change? *
    6·1 answer
  • Magma rises towards the earth's crust as lava and cools down and crystallizes to form rocks. true or false help
    14·1 answer
  • Which of the following numbers, on the pH scale, would indicate that a substance is acidic? Group of answer choices 12.0 13.5 8.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!