1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
8

If you were given an unknown solution and no PH paper, could you determine whether it is acidic, basic or neutral using only the

three indicators? (Phenolphthalein, bromthymol blue and methyl red) Explain?
Biology
1 answer:
Luba_88 [7]3 years ago
6 0

Answer: The three given indicators can be used for testing whether the given solution is acidic, basic or neutral.

Phenolpthalein: It shows fuchsia color if the solution is basic in nature and remains colorless if the solution is acidic in nature.

Bromophenol blue : It shows yellow color in acidic solution and purple color in  basic solution.

Methyl red: It is red in acidic solution and yellow in basic solution.

If the solution is neither acidic nor basic then definitely it is neutral.

You might be interested in
The Center for Disease Control publishes articles explaining the causes of seasonal West Nile virus. Research proves mosquitoes
nata0808 [166]

Answer:

1. D

2. B

Explanation:

1.They inject the virus when sucking out the blood.

2. Bear/Mouse because bears don't seek out and eat mice.

4 0
3 years ago
. The nitrogen that exists on Earth was created by nitrogen-fixing bacteria. True or False
Vanyuwa [196]

Answer:

Verdadero

Explanation:

7 0
3 years ago
What is the circulation of lichens? <br> Artic <br> Global <br> Tropical <br> Unplanned
riadik2000 [5.3K]
Tropical?
Imnsorry if im uncertain i just wanna help
3 0
3 years ago
Read 2 more answers
Why do nuclear reactor sites require high levels of regulation? Select all that apply the chain reaction must be controlled at a
Aleks [24]
- <span>the chain reaction must be controlled at all times without proper cooling the reactor will overheat

- </span><span>radiation leaks can cause death and destruction to nearby life </span>
6 0
3 years ago
Read 2 more answers
The most frequent way in which small regulatory rna molecules exert their effects is by the most frequent way in which small reg
Sophie [7]
For the answer to the question above, I believe the answer here is that you must base the pairing with the other RNA molecules <span>that have regions of the complementary sequence.

I hope my answer helped you. Have a nice day!
</span>
7 0
3 years ago
Other questions:
  • Which of the following statements is the correct comparison of selective breeding and hybridization?
    5·2 answers
  • Which nervous system division is responsible for the integration of sensory information?
    10·1 answer
  • The cell in this part of a plant transport water and nutrients throughout the plant. what is the most likely structure of specia
    13·1 answer
  • Molecular clocks
    7·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is the common name for the boston fern
    11·2 answers
  • Unlike other organelles, ribosomes are not surrounded by a
    13·2 answers
  • Glycerophospholipids are __________. View Available Hint(s) Glycerophospholipids are __________. derivatives of triacylglycerols
    10·1 answer
  • Answer the following using directional terms specific to the dentition. a Your canine is _______________________________________
    12·1 answer
  • Type your response in the box.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!