1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
3 years ago
8

The four principles of natural selection

Biology
1 answer:
natima [27]3 years ago
5 0

1) Variation: there needs to be a difference in the individuals within a population

2) Inheritance: These variable traits must be able to be passed down genetically

3) Growth rate: There needs to be a growth rate that requires a struggle for resources

4) Survival rate: There needs to be a difference in survival rate for the different variation types... certain variations will live

You might be interested in
Compare each patient's cdna sequence to the wild-type cdna sequence. Each patient has one nucleotide-pair substitution mutation.
Lera25 [3.4K]

The mutation is a change in the nucleotidic sequence. In the exposed example, Patient 1: nucleotide 143, T<u>T</u>C⇒T<u>G</u>C. Patient 2: nucleotide 143, T<u>T</u>C⇒T<u>C</u>C. Patient 3: nucleotide 147, TT<u>C</u> ⇒ TT<u>G</u>.

<h3>What is a mutation?</h3>

A mutation is a change or alteration in DNI sequences that introduce new variants.

Many of these are eliminated, but some of them might succeed and be incorporated into each individual.

These mutations are the ones that have been selected by natural selection.

<h3>Solving the problem</h3>

We know that each sequence initiates with nucleotide number 103 and ends in nucleotide 162.

So first, we will number the nucleotides, from 103 to 162. Each nucleotide has a number in increasing order.

Now, we will identify the mutations in each of the strands by comparing them with the wild-type sequence. The mutation occurs in one of the nucleotides, so we must look for the change in the bases.

Finally, we will identify the nucleotide location of each mutation.

                   nucleotide                 wild-type                mutated

<u>                       location                 nucleotide              nucleotide      </u><u>           </u>

Patient 1            143                         TTC                         TGC

Patient 2           143                         TTC                         TCC

<u>Patient 3           147                          TTC                        TTG                         </u>

<u />

In the attached files you will find an image for a better understanding.

You will learn more about mutations at

brainly.com/question/4347425

brainly.com/question/17914937

 

3 0
2 years ago
Conservation biologists provide strong arguments about why we should all care about preserving biodiversity. When considering th
Ahat [919]

Answer:Increase in ambient global temperatures.

Recyling energy to be used again

Regulation of oxygen and carbon dioxide levels

An increase of erosion and siltation along waterways

Explanation:

Conservational biologists think about the preservation of ecosystem by maintaining the environment in a human control way.

Increase in ambient global temperatures.: The humans must prevent the increase in global temperature worldwide by preventing the rise of greenhouse gases which can lead to global warming worldwide.

Recyling energy to be used again: The sources of energy like wood, waste water can be recycled again for reutilization.

Regulation of oxygen and carbon dioxide levels.: The oxygen and carbon dioxide levels must be regulated. As oxygen is the basic requirement for respiration. The increase in carbon dioxide levels due to human activities is likely to cause respiratory diseases and health hazards in living beings.

An increase of erosion and siltation along waterways.: The erosion and siltation will likely to deposit nutrients and debris which may either contaminate the waterway or may cause eutrophication.

5 0
3 years ago
Hydrogen bonds can form between regions of polar molecules that are
nataly862011 [7]
Hydrogen bonds can form between regions of polar molecules that are <span>oppositely charged.

Source credit: </span>https://quizlet.com/16761990/biology-chapter-22-saud-flash-cards/
5 0
3 years ago
PLEASE HELP
Doss [256]

Explanation:

I'm not an expert or sum, but with using logic I would choose: DNA plays a role in the growth and reproduction of organisms, DNA guides the formation of an organism's structures.

3 0
3 years ago
Read 2 more answers
Which nutrients play an important part in chemical reactions within cells? carbohydrates proteins fats minerals
stiv31 [10]

Answer:

proteins

Explanation:

- proteins help the cells grow

-proteins are also considered to serve as a source of energy

HOPE IT HELPS :)

PLEASE MARK IT THE BRAINLIEST!

7 0
3 years ago
Read 2 more answers
Other questions:
  • An individual’s behavior characteristics, emotional expression, and intensity that is established from birth is known as _______
    8·2 answers
  • In the hierarchy of scientific thought, a hypothesis: A. Comes right before law B.has the most certainty C. is the least certain
    6·2 answers
  • Is mold abiotic or biotic
    14·2 answers
  • What is a major difference between mitosis and meiosis I in a diploid organism?
    13·2 answers
  • Recombinant DNA technology involves which sequence of steps?
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of the following events happens during anaphase?
    8·1 answer
  • How does cellular respiration provide energy for life processes?​
    8·1 answer
  • (a) The consequences of a growing human population have been a concern since the times of Thomas Malthus when he proposed that h
    12·1 answer
  • Please help asap I have to turn it in , in 5minutes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!