1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
8

What degree longitude is the eastern border between alaska and canada?

Geography
1 answer:
77julia77 [94]3 years ago
4 0
141 meridian west i think. dont quote me here
You might be interested in
The Supreme Court ruled _____ was unconstitutional?
bazaltina [42]
First off why is this Geography. I am going to yolo this and say segregation was unconstitutional. <span />
6 0
3 years ago
Read 2 more answers
Why might an NGO try to influence the united states? PLEASE ANSWER FAST!!!!!
Assoli18 [71]

NGOs have the greatest influence on environmental policy, women's issues, development and human rights. In these issue areas, they use the media and lobbying of individual governments to set the U.N.'s agenda; they lobby in New York and Geneva to obtain U.N. ... provides three monitoring mechanisms for NGOs to use.

8 0
3 years ago
Often plate boundaries move in such a way that the crust is neither created nor destroyed, what type of force is this
Sliva [168]

Answer:

I think its shear

Explanation:

8 0
3 years ago
Mount Erebus, an active volcano, is located __________. A. in Australia’s Snowy Mountains B. on New Zealand’s North Island C. in
nydimaria [60]
The right answer to this question is C. in Antartica
9 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • The most important measure of the size of a river is the
    5·1 answer
  • In what region is each state located?
    5·2 answers
  • The belief that we inherit tried and true ways of adjusting to the environment from past generations is referred to as ______ ev
    7·1 answer
  • Which of the following events did not occur as a result of the Australian government taking back 13,000 acres of land from Abori
    13·2 answers
  • Charlie uses the function f(x) = 2x2 + 5x + 3 to track the temperature of a substance, where x represents the time. When you eva
    6·1 answer
  • 50 POINTS
    14·1 answer
  • What state migrated the most to Texas in 1850?
    8·1 answer
  • What happens since natural vegetation has cleared​
    11·1 answer
  • Why is deforestation bad?
    8·1 answer
  • Identity the number that goes with each physical feature (due soon :,) )
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!