1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
8

How does altered ventilation and diffusion affect these processes?

Biology
1 answer:
mestny [16]3 years ago
3 0
<span>Lungs take in air, and diffuse (absorb) air into the capillaries of the blood. However, this process is two steps, one for inhalation and one for exhalation. Diffusion takes place in both processes, and serves different purposes. One is to absorb oxygen, the other is to rid co2.</span>
You might be interested in
Water-soluble nutrients absorbed into the blood are routed directly from the small intestine through the portal vein to the ____
bixtya [17]
Water-soluble nutrients stored in blood are routed directly from the small intestine through the portal vein to the liver before any other organ. The portal vein or hepatic portal vein is a blood vessel which carries blood from the GI tract, to the liver. The blood contains nutrients and toxins extracted from digested contents. The portal vein is not a true vein, since it conducts blood to capillary beds in the liver and not directly to the heart. It is the main component of the hepatic portal system.
7 0
3 years ago
Like a key in a lock, the shape of the _____ must bind with the _____ of the receiving neuron.
likoan [24]

Neurotransmitters are the chemical molecules, which help in transfer of the signals from one neuron to another. Inside the neurons, the signals are transferred as electrical signals, but at junction of two neuron, which is known as synapse, the signals are transferred in chemical forms.

These neurotransmitters have a definite shape and are recognized by the receptors present in the receptor site of the succeeding neuron. The neurotransmitters from the synapse binds to the receptor site of the receiving neuron. binding of the neurotransmitter to the receptor causes excitation of the receiving neuron, which also known as postsynaptic neuron.

Hence, Like a key in a lock, the shape of the neurotransmitter must bind with the receptors of the receiving neuron.

5 0
2 years ago
Using complete sentences, compare and contrast the terms living and biotic. In your response, illustrate using examples and appr
fenix001 [56]
Biotic and living are the same thing, abiotic would be non-living
7 0
3 years ago
Read 2 more answers
Which tho structures ate not found in animal cell
UkoKoshka [18]

The cell wall and chlorophyll are not found in animal cells.

Hope this helps!

-Payshence

6 0
3 years ago
Describe the passage of a meal containing bread through your digestive system
Alex777 [14]

Before your food passes from the mouth and down your esophagus, salivary amylase, an enzyme in saliva, begins to digest the starch in your bread. That is the start of chemical digestion. ... The passage of the bolus through the esophagus to the stomach occurs by peristalsis, a series of wave-like muscle contractions.

7 0
2 years ago
Other questions:
  • Which glands produces hormones that help to regulate body metabolism?
    10·1 answer
  • in figure 34-1 structure F produces which of the following hormones when you're feeling stress about a big test
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • About 45 to 60 minutes after LTP, all of the following occur among dendritic spines EXCEPT ______.
    8·1 answer
  • Select all choices that apply. Which of the following statements apply to the New Kingdom? Choose all answers that are correct.
    11·2 answers
  • Which organelle houses the genetic material DNA?
    8·2 answers
  • Fossils reveal the body structures of ancient organisms. What other information is LEAST
    9·1 answer
  • What is the complementary DNA strand for the following. ATTGCACGA
    15·2 answers
  • What are three ways a plant's organ systems work together?
    6·2 answers
  • Which of the following is true about the color of a substance?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!