1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
3 years ago
9

Which protozoan can infect the urinary tracts of males?

Biology
2 answers:
Mice21 [21]3 years ago
8 0

Trichomoniasis is the correct answer

vivado [14]3 years ago
6 0
Answer - Trichomoniasis 

Reasoning - Trichomoniasis is a type of parasitic organism that will infect and use its host as a nutrition base. Causes disease and other harmful chemical substance to the body.

You might be interested in
4. All of the following are limiting factors to a population EXCEPT
Rzqust [24]

Answer: I think it is d

6 0
3 years ago
Write a poem about symbiotic relationships. It must include Commensalism Mutualism, Parasitism, Competition, and Predation.
statuscvo [17]

Answer:

Explanation about Commensalism Mutualism, Parasitism, Competition, and Predation are given below.

Explanation:

There are various symbiotic relationship formed between the organisms present in the environment. These relationships are Commensalism Mutualism, Parasitism, Competition, and Predation. In Commensalism relationship, one organisms gets benefits while the other neither get benefit nor harm. In mutualism, both organisms gets benefits from one another. In Parasitism, one organism get benefits and the other get harmed. In Competition, both organisms cause harm to one another and both are damaged through their actions and in Predation, one organism is benefited by killing the other organism to feed itself.

3 0
2 years ago
In a food web, there are producers, consumers, and decomposers.
Aliun [14]

Answer:

True

Explanation:

3 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Which of the following most significantly determines a community's access to potable water?
Solnce55 [7]

Answer:

<em>The correct option is B) the availability of money</em>

Explanation:

Potable water can be described as the water which is safe to drink. Nowadays, with the rapid industrialization progress, it is important to process water so that it can be used for human consumption. The processing of water to make it clean enough requires money. The more money a community will have, the more machinery and plants it will be able to set up for the processing of water.  

7 0
3 years ago
Read 2 more answers
Other questions:
  • Caregivers who suspect resident abuse are expected to __________.
    6·1 answer
  • Amino acid molecules are bonded together in a specific sequence on cell structures known as?
    8·1 answer
  • A meadow ecosystem includes many species of grasses and small shrubs, several herbivores, and a few carnivores. A fungus coloniz
    5·2 answers
  • The 1918 influenza epidemic killed between 50 million and 100 million people worldwide. This epidemic happened near the end of W
    15·2 answers
  • How are organisms classified into their different domains and kingdoms?
    12·2 answers
  • Two cities are separated by 200 miles. City X has an altitude of 122 meters and City Y has an altitude of 260 meters. Calculate
    9·1 answer
  • The breeding of organisms over many generations in order to achieve a desirable phenotype?
    13·2 answers
  • Explain what is meant by the statement
    14·1 answer
  • Organelles can be thought of as what
    15·1 answer
  • arrange the following events in the correct order, from left to right, with respect to the function of the channels, ion permeab
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!