1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
4 years ago
6

How would you predict the climate to change on Islands if the Gulf Stream did not exist?

Biology
1 answer:
Maslowich4 years ago
7 0
In the Earth’s past, scientists have seen evidence of large inputs of fresh water into the North Atlantic from melting glaciers and ice caps as well as changes in the thermohaline circulation during transitions in and out of glacial periods. Global warming could potentially cause a thermohaline circulation shutdown and subsequent regional cooling, but because Earth will continue to warm as a result of greenhouse gas emissions, it would not produce another Ice Age. If the thermohaline circulation shut down, cooling would likely occur only in regions that are currently warmed by the ocean conveyor. And even if the thermohaline circulation did shut down, winds would still likely drive the Gulf Stream; however, there would be less warm water from the tropics and the Gulf Stream could become cooler and not reach as far north
You might be interested in
Flexible tough material that makes up vertebrate skeletons or parts of<br> the system
larisa [96]

Answer:

<u>Cartilage</u> is the flexible, tough material that makes up vertebrate skeletons or parts of the skeletal system.

Explanation:

Cartilage is the part of skeletal system that acts as a connective tissue too. It is comprised of chondrocytes cell types (formed by chondrification) and produce collagen and proteoglycan. It provides elasticity and found in the rib cage, nose, ear, and in the Intervertebral discs. It is abundantly present in infants but at later growth stages, bone maturation process takes place which replaces/hardens the cartilage with hard bones.

6 0
3 years ago
Which question is true about food chains A. All food chains start with consumers B. The arrow shows the movement of energy C. Th
Masja [62]
B- The arrow shows the movement of energy
3 0
3 years ago
Read 2 more answers
How might a weathered mountain appear different from an unweathered mountain?
Zanzabum
<span>The weathered mountain will appear rounder in shape.

Hope this helps!</span>
5 0
3 years ago
Read 2 more answers
How many marine species are harmed by plastic pollution?
Oliga [24]
700 marine species.
8 0
3 years ago
The image below was generated by the National Oceanic and Atmospheric Administration (NOAA) to monitor weather systems that coul
OLga [1]

Answer:yo no se mucho de esto pero yo creo que es la A por que el clima cambia siempre por ejemplo un dia es soliado y al dia siguiente es nublado o algo asi y es cierto el clima cambia constantemente como las personas

Explanation:

4 0
3 years ago
Other questions:
  • How is reproductive isolation related to the formation of new species?
    8·1 answer
  • A student plants an experiment to find out if house plants will grow faster when they are watered more . Describe two variables
    10·1 answer
  • Body's major metabolic hormone is called
    8·1 answer
  • Wich of the following is a property of water
    8·2 answers
  • Is euglena considered an animal or plant organism
    7·2 answers
  • Weathering can be either a chemical or a physical process. The action of water causes physical weathering of rock. Which example
    15·1 answer
  • Which maps is an example of a Mercator projection?
    8·2 answers
  • What occurs when molecules move into a cell by fusing with the membrane
    14·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Which of the following factors is most likely to contribute to gene flow between the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!