1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmainna [20.7K]
3 years ago
8

In type 1 diabetes, the body fails to produce insulin, and thus individuals must inject themselves with insulin before eating. b

ased on your knowledge of the control of glucose levels in the blood, what would be the result of a type 1 diabetic injecting himself with too much insulin
Biology
1 answer:
Tpy6a [65]3 years ago
8 0
Too much glucose is converted to glycogen. This results in dangerously low glucose levels in the blood, also known as hypoglycemia.
You might be interested in
The term __________ refers to lack of control over bowel movements that is not caused by an organic problem.
damaskus [11]

The term faecal incontinence refers to lack of control over bowel movements that is not caused by an organic problem.

The inability to control bowel motions results in faeces (stool) leaking unexpectedly from the rectum in faecal incontinence. Fecal incontinence, also known as bowel incontinence, can range from the infrequent leakage of faeces when passing gas to a total lack of bowel control.

Faecal incontinence is frequently brought on by muscle or nerve injury, constipation, and diarrhoea. Damage to the muscles or nerves may be brought on by ageing or giving birth. Faecal incontinence can also develop in those who are unaware that they need to pass stool. We refer to this as passive incontinence.

Therefore, The term faecal incontinence refers to lack of control over bowel movements that is not caused by an organic problem.

Learn more about faecal incontinence here;

brainly.com/question/8822587

#SPJ4

4 0
2 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
The circulation disperses oxygen rich blood throughout the body is called
-Dominant- [34]

Answer:

Major circulation or systemic circulation

Explanation:

It is the process when our heart expulses blood of a chamber called left ventricle and moves to aortic artery and then the blood goes to arterioles and capillaries supplying the oxygen and nutrients that every cell in our body needs.

3 0
3 years ago
Which RNA types are involved in translation?
Nezavi [6.7K]
C. Is the answer for sure
4 0
3 years ago
HELP ME OUT PLEASE!
natka813 [3]

omg... that's really hard and i don't know what the answer is.

Explanation:

by the way, thanks for points

5 0
2 years ago
Other questions:
  • Can you help me please i will give you a branlist and it’s science
    13·1 answer
  • Which of the following leaf adaptations is not matched with its reason for variation? A) needles - protection B) succulents - wa
    15·1 answer
  • What will be the most likely result if an ecosystem tries to exceed its carrying capacity?
    6·1 answer
  • Examine the following scenario:
    12·1 answer
  • The big bang theory states that the universe was formed as the result of a huge explosion.   How did the universe begin, accordi
    14·1 answer
  • Why are bacteria needed in the nitrogen cycle?
    10·1 answer
  • Which of these cell structures is used to transport chromosomes across a cell during cell division?
    5·1 answer
  • Please help me asap!!!!
    15·1 answer
  • If the mass of each dialysis bag shown in the experimental set-up below is measured before each is immersed in its respective so
    15·1 answer
  • Which of the following is a BEHAVIORAL adaptation?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!