1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hitman42 [59]
3 years ago
9

blank molecules make up proteins A. Carbohydrate. B. carbon dioxide. C lipid. C amino acid D water or E. hydrogen

Biology
1 answer:
Mademuasel [1]3 years ago
3 0
The answer is A
(don't quote me on it)
<span />
You might be interested in
while washing her hair olivia noticed that she was losing a lot of hair she visited a clinic and the physician reassured her tha
Julli [10]

Answer:

This is a temporary problem which can be regained as losing hair is not a permanent problem and it can be regrown after a period of time.

The problem can be due to stress conditions, poor diet, certain types of drugs and surgery can be one of the reasons of temporary hair loss.

The hair starts regrowing and the hair follicles is stimulated for the growth of hair and it takes 3 to 6 months by the hair to grow.

So, after treatment, proper diet and medication Olivia will have her hair back.

3 0
3 years ago
Is glasses a abiotic or biotic
Mandarinka [93]
Glasses are abiotic because they are nonliving.
3 0
3 years ago
What are the two classes of cells found in the human body
MatroZZZ [7]

Answer:  the answer is c

Explanation:

3 0
3 years ago
Which if the following conditions best match this graph:
postnew [5]
I say A they dont neither grow or lower. and if they do they go back to normal
3 0
3 years ago
Read 2 more answers
What is one difference between DNA and RNA?
uranmaximum [27]
There are multiple differences between RNA and DNA
1.  DNA has two strands whereas RNA has one
2. DNA has deoxyribose sugar while RNA contains ribose sugar
3. DNA contains thymine instead of RNA's uracil
4. DNA cannot leave the nucleus and RNA can (mRNA)
3 0
3 years ago
Read 2 more answers
Other questions:
  • How does oxygen concentration affect the fish that live in a pond
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Most biologist use six kingdoms into which they organize all living things
    8·1 answer
  • State the characteristic of tracheoles that help with gaseous exchange<br>in insects.​
    11·1 answer
  • Gordon is having trouble sleeping and decides to take a supplement containing a hormone that is manufactured in the pineal. What
    14·1 answer
  • A 25-year-old woman was planning a backpacking trip in Honduras. Three days after her arrival in the country, she developed wate
    12·1 answer
  • 4. Which is an example of a species<br> a) Big Fish<br> b) Insects<br> c) Cricket<br> d) Small Dog
    15·1 answer
  • Which of the following substances is not normally found in filtrate?
    10·2 answers
  • Joe first focuses his attention (and his eyes on the tree. the focal length of the cornea-lens system in his eye must be _______
    7·1 answer
  • How do frogs and toads, as well as salamanders, typically protect themselves from predators?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!