1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gogolik [260]
4 years ago
6

If a patient complained of a "stomach ache" and pointed to the umbilical region as the site of discomfort, which organs located

in this region might be the source of the pain?​
Biology
2 answers:
Ilia_Sergeevich [38]4 years ago
8 0
It might be the digestive pain
wlad13 [49]4 years ago
7 0

Answer:

There are a couple of options

1. Ulcers in stomach

2. Obstruction in the small intestines

3. Pancreatitis - depends on which side the patient is pointing to

4. Aneurysm

You might be interested in
During the cell cycle, the complete period of non division is called what?
NeTakaya
The complete period of non division during the cell cycle is G0 (Gap zero).
6 0
3 years ago
A given ecosystem has the following amounts of energy available at each trophic level: Primary producers: 4,000 gC/m2/day; Prima
schepotkina [342]

Answer:

b. Yes, the average efficiency is 10%

Explanation:

The average efficiency at each trophic level is 10% because there is about 10% of energy is transferred from one trophic level to another. In some trophic levels the efficiency of organisms is 20% but in most of the trophic level has 10% efficiency so that's why the average efficiency is 10%. Yes, this ecosystem  obeys the Lindeman's Law for ecological efficiency due to its 10% of ecological efficiency.

4 0
3 years ago
Explain the meaning of the symbols as they are used in this expression.
Dmitrij [34]

Answer:

  • A, B, C and D are: elements or molecules
  • A and B are: reactants
  • C and D are:  products

Explanation:

The expression "A + B <--> C + D" represents a chemical equation. A chemical equation represents the "mixture" of molecules or elements that will react and form other molecules and elements, so we can say that A, B, C and D represent molecules or elements.

But not only that. In a chemical equation, the elements and molecules that are before the symbol "<-->" represent the reagents in the equation. Therefore, A and B are the reagents. The elements or molecules found after the symbol "<-->" are the products of the reaction. Therefore, C and D are the products.

7 0
3 years ago
Read 2 more answers
The image to the left shows Earth’s major plates. A geologist is studying a plate boundary indicated by the arrow.
natita [175]

Answer: Eurasian

That's the right answer.

4 0
3 years ago
Read 2 more answers
What are the products of cellar respiration
White raven [17]
ATP and carbon dioxide
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which timeline best shows the history of the development of cell theory?
    14·2 answers
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • Refer to the illustration of the leaf cross-section. The vein is made up of _________.
    6·2 answers
  • What is the body's first line of defense against disease?
    5·1 answer
  • A group of similar cells that perform a similar function is called a(n)
    15·1 answer
  • A point mutation that results in the substitution of one amino acid for another within a protein is a ______.
    14·1 answer
  • What is/are one of the environmental waste products of nuclear energy?
    7·2 answers
  • What is the current world population?
    15·1 answer
  • Can someone tell me what I got wrong out of these 9?
    5·1 answer
  • What is the density of a material that has the volume of 24.0 mL and a mass of 53.0 g
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!