1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
9

In what way are mitochondria and chloroplasts similar to some prokaryotes cells

Biology
1 answer:
Yanka [14]3 years ago
6 0
Even though both organelles are found in eukaryotic cells<span>, both </span>mitochondria and chloroplast<span> have characteristics often found in </span>prokaryotic cells<span>. These </span>prokaryotic cell<span> characteristics include: an enclosed double membrane, circular DNA, and bacteria-</span>like<span> ribosomes.</span>
You might be interested in
Which of the following is NOT part of modern cell theory?
mote1985 [20]

Answer: the answer is b

Explanation: cells are able to synthesize their entire complement of

Biomolicules

6 0
3 years ago
Read 2 more answers
What should I do I don't know
Rom4ik [11]
A molted external skeleton. 
6 0
3 years ago
Read 2 more answers
Two groups of students were tested to compare their speed working on math problems. Each group was given the same problems. One
jasenka [17]
Manipulated Variable:The speed working on maths problems
Responding Variable: The group that use¬ using a calculator
Controlled Variable:The same maths quetions
8 0
3 years ago
Why do you think are the reasons why only few seeds germinate​
Svetlanka [38]
The first reason is that Thats because the seeds will remain dormant until they have the resources they need for eg: some seeds are frozen in winter so that they wont germinate until they have enough resources in spring .
3 0
3 years ago
Read 2 more answers
Which of the following is most easily changed to alter resistance?
Leya [2.2K]

Answer:

Answer is C.

Explanation:

A. The vessel length is pretty much constant. The body can't length or shorten blood vessels.

B. Blood viscosity is also fairly constant because the composition of blood cannot change quickly enough to change resistance as needed.

C. This is the main way resistance is controlled. The smooth muscle surrounding blood vessels can rapidly respond to hormonal or metabolic stimuli and contract/relax to adjust diameter.

D. Again, temperature is fairly constant in the body and would not be a good way to alter resistance.

7 0
3 years ago
Other questions:
  • The Treaty of Paris strain the American alliance with the French. What is the reason behind it?
    12·2 answers
  • Evidence suggests that the crocodiles are more closely related to the birds than the turtles and snakes. If so, then including c
    12·2 answers
  • Consider the model of the food chain. Imagine there is a herbicide poison spill and all the grass is killed. How will this influ
    14·2 answers
  • Need help ranking the planets in order.
    14·2 answers
  • Structurally, DNA and RNA nucleotides are similar, although their three basic components differ slightly. One way DNA and RNA di
    9·1 answer
  • PLEASE HELP ME ON QUESTION 10 ASAP!!!!!! GIVING 20 POINTS!!!!!!!!!!!!!!!!!!
    8·1 answer
  • What would happen in a cell if cellular respiration stopped?
    7·1 answer
  • What are two parts that all fish share
    14·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Among us code:<br> SRCSMF
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!