1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
4 years ago
6

Growth spurt during puberty results from cell proliferation and hypertrophy in what

Biology
1 answer:
nikitadnepr [17]4 years ago
6 0
Hormones changing in the body
You might be interested in
A policy that rewards a
ioda

Answer: Economic Incentive

Explanation:

6 0
3 years ago
Read 2 more answers
Which is NOT a way in which prokaryotes are useful to humans?
Fynjy0 [20]
The answer is <span>to form a symbiotic relationship and obtain ammonia. Hope this helps!</span>
7 0
3 years ago
Describe how a sedimentary rock, such as sandstone, forms.(Need help ASAP!!)
Leviafan [203]

Answer:

They form when sediment accumulates.

Explanation:

Sediment is deposited out of air, wind, gravity; sediment is formed when weathering and erosion break down a rock into loose source material in a source area.

6 0
3 years ago
Why do we only see one side of the moon?
djverab [1.8K]
Because we spin on a side ways axis only showing on side at the time, and the moon also rotates so we don't only see one side of the moon, we only see what our eyes percieve

6 0
4 years ago
Read 2 more answers
What two kingdoms are symbotic
Marianna [84]

Answer:

, Carolus Linnaeus

Explanation:

3 0
4 years ago
Other questions:
  • Why are producers important to energy transfer within an ecosystem?
    13·1 answer
  • Can someone help me please?!
    11·1 answer
  • When spread out and viewed with electron microscopy, an active rrna gene looks like a?
    7·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • In the unilocular adipocyte, Which organelle is more developed and why?
    6·1 answer
  • Synovial joints may include cartilage, ligaments, tendons, and synovial fluid. Which of these attach(es) bones to other bones wi
    13·1 answer
  • Dr. Alexander Winemann is a ____ist who specializes in organic chemistry.
    7·1 answer
  • HURRY I DONT HAVE ALOT OF TIME
    13·1 answer
  • Which type of tree ends up dominating many landscapes over time because they will slowly make it harder for other types of trees
    11·1 answer
  • A student is asked to design an investigation which will cause an object to have motion that matches the graph she was given.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!