1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semmy [17]
2 years ago
8

Study the diagram about the varying pressures of Earth’s Layers. Earth apostrophe s layers. The Crust at depth of 0 kilometers,

upper mantle depth 410 kilometers, lower mantle depth 2,900 kilometers at 125 gigapascals, 2,200 degrees Celsius. Outer core depth 5,100 kilometers at 330 gigapascals, 5,000 degrees Celsius. Inner core at 364 gigapascals, 5,500 degrees Celsius. Which is the best estimated pressure, represented in units of GPa, of the lower mantle? 110 GPa 220 GPa 305 GPa 360 GPa
Biology
2 answers:
vova2212 [387]2 years ago
5 0

Answer:

The correct answer is A. 110GPa

Explanation:

Pressure refers to a force applied to a surface or object either by another object or factors such as the atmosphere. This is calculated considering the force applied and the area. Additionally, this factor can be measured using the unit gigapascals (GPa), which is more common in geography and related areas.

In this context, the lower mantle, which is the layer below the upper mantle has a pressure between 24GPa and 130GPa; and this is a high pressure if compared to the pressure in the surface. Thus, the estimated pressure in this zone is 110GPa because this is the only number that is between the range of pressure in this zone, while others show a higher pressure that is not found in this layer.

Leona [35]2 years ago
5 0

Answer:

The correct answer is A

Explanation:

You might be interested in
What are to two types of gametes?A gamete is also known as?
STALIN [3.7K]

Answer:

What are to two types of gametes?

Sperm and Egg

A gamete is also known as?

Sex cells

What is the process called when the fusion of gametes create a zygote?

Fertilization

Is a zygote a diploid of haploid cells?

Diploid

<u>-TheUnknownScientist</u>

5 0
2 years ago
Read 2 more answers
What may have helped horses change over the last 40 million years? A) an increase in their height and weight B) the coming and g
melisa1 [442]

A change in their food, from trees to grass in the Great Plains.

5 0
3 years ago
Read 2 more answers
All of the following are typical physiological effects of dehydration except _______. Multiple Choice increased blood osmolality
Tatiana [17]

According to the research, all of the following are typical physiological effects of dehydration except <u>osmolality decreased</u>.

<h3>What is dehydration?</h3>

It is the process that refers to eliminating or losing the water that is part of the composition or that contains an organism.

Among the most frequent effects are thirst, osmolality increases, increased sweat rate, dry skin and fatigue.

Therefore, we can conclude that according to the research, all of the following are typical physiological effects of dehydration except osmolality decreased.

Learn more about dehydration here: brainly.com/question/12261974

#SPJ1

3 0
1 year ago
Which type of heat transfer causes a person sitting by the fire to feel warm?
Sergeu [11.5K]

Radiation

The fire radiates heat and the human body absorbs said heat.

5 0
3 years ago
Read 2 more answers
Which would happen if more forests were cut down?
IceJOKER [234]
The amount of co2 in the atmosphere would increase

hope this helps
4 0
2 years ago
Read 2 more answers
Other questions:
  • A receptor is a structure that detects stimuli. The stigma (eyespot) of Euglenoids detects ____, assisting with phototaxis. A. l
    6·1 answer
  • What would you except to happen if you rubbed a mineral of hardness 7.5 against a piece of quartz
    14·1 answer
  • A property of life known as energy processing refers to the fact that living things:_______.A. can reproduce.B. obtain energy fr
    8·2 answers
  • What happens to macromoleclues from food during digestion
    8·2 answers
  • A scientist wants to test how much of an acid can be added to a solution
    13·1 answer
  • Help, please! When there is an imbalance in a body system, and the body cannot maintain homeostasis, how might other systems res
    9·1 answer
  • Frogs are primary and secondary consumers or secondary and tertiary consumers?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Nêu 2 cách hoạt động của glutathion trong tế bào hồng cầu
    14·1 answer
  • Motion is needed for work to have been done true or false
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!