1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
6

Mitral valve prolapse severe enough to cause regurgitation may directly cause _________________ pressure in the ____________ atr

ium.
Biology
1 answer:
GenaCL600 [577]3 years ago
7 0
Mitral valve prolapse severe enough to cause regurgitation may directly cause INCREASE pressure in the LEFT atrium. Mitral valve prolapse is a medical condition in which the the two valve flaps of the mitral valve do not close properly, bulging upward into the left atrium. The condition may be mild or severe. Heart surgery may be required in case of the severe one.
You might be interested in
Convergent evolution can occur only when two species
ANTONII [103]
Convergent evolution can occur when two different species adapt similarly due to their habitat and environment.
3 0
3 years ago
What are three major island arc
Tju [1.3M]
The three major islands are Japan, Indonesia and New Zealand. 
7 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Defecation depends on
ASHA 777 [7]

Answer: the correct answer is d. all of the above must happen for defecation to occur.

Explanation:

In response to the distention of the rectal wall, the receptors send sensory nerve impulses to the sacral spinal cord. Motor impulses from the cord travel along parasympathetic nerves back to the descending colon, sigmoid colon, rectum, and anus. The resulting contraction of the longitudinal rectal muscles shortens the rectum, thereby increasing the pressure within it. This then opens the internal sphincter.

6 0
3 years ago
Studies suggest that the incidence of colon cancer may be lowered with high fiber diets. how might this be explained?
Triss [41]

The increase in the high fiber diet reduces the risk of colon cancer is suggested by the researchers. The effect of high fiber dietary intake add bulk to the digestive system. It also reduces the time required by the food to travel from the colon. Our food often contains some carcinogenic contents, so the interaction of such carcinogens may also be reduced due to the high fiber diet and also reduces the risk of intestinal tract. The bacteria in the lower intestine breaks the fibers into butyrate, which inhibits the growth of tumors of the colon and rectum.

7 0
3 years ago
Other questions:
  • How can i increase an object’s Kinetic Energy?
    14·1 answer
  • Ariel drew a diagram to compare two human-induced environmental changes.
    9·2 answers
  • Which of the following is most likely to result in an action potential at a postsynaptic neuron? Which of the following is most
    6·1 answer
  • How does the ocean help to maintain moderate temperatures across the globe? by increasing the wind speed around the globe, by be
    15·1 answer
  • The oil producing glands of the skin are called
    8·1 answer
  • Imagine that a man is scratched by his cat. A phagocyte near the scratch site recognizes and engulfs a bacterium. Shortly therea
    8·1 answer
  • In lateral gene transfer, genes are ______.
    8·1 answer
  • You are studying flower color and find that purple flowers are dominant to white flowers. When a certain purple flowered plant w
    15·1 answer
  • We eat food for nutrients and energy. Our digestive system does the work to physically and chemically digest or decompose the fo
    15·1 answer
  • during a solar eclipse, the sun apears to go either fully or partially dark. Why can solar eclipses only be observed on certain
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!