Answer:
fhujwgsyr0t,bafeu7327 v kgkyahxbspyuwsbxtednzbbxywtoxjhstodkxns7ibzmcnxylymidxnnxhsushxnn nùý7hõ
Explanation:
ek6x6justifi occur class 4A Roll on bed with OUT cloths in Telugu of flag for this no questions asked about it was very 5A
Answer: A river is a flowing, moving stream of water that feeds into a body of water.
Answer:
Explanation:
The water cycle is important because water sustains all life on Earth. Through a series of evaporation, transpiration, condensation, precipitation, infiltration, runoff, and other smaller processes, the water cycle keeps the Earth's water clean, distributes the water across the planet's surface, maintains aquatic ecosystems, and aids in the process of plant growth. The water cycle not only keeps all living things alive, but it's become an important tool for the modern human race. Climate change is altering patterns of weather and water around the world.
Answer:
<u>Geocentric Model</u>: - this model is Earth Centered
-Retrograde motion is explained by epicycles
<u>Heliocentric Model</u>: - This model is Sun Centered
-Retrograde motion is explained by the orbital speeds of planets
<u>Both models</u>:- Epicycles and deferents help explain planetary motion
-Planets move in circular orbits and with uniform motion
-The brightness of a planet increases when the planet is closest to Earth
Explanation:
Retrograde motion is an apparent change in the movement of the planet through the sky. Ptolemy's model of the solar systems was geocentric, where the Sun, Moon, planets and start all orbit the Earth in perfectly circular orbits. However this perfectly circular orbits around the Earth did not explain the occasional retrograde motion of the planets. In the Copernicus' heliocentric model, retrograde motion of planets is naturally explained. The explanation for retrograde motion in a heliocentric model is that retrograde occurs roughly when a faster moving planet catches up to and passes a slower moving planet.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
