3 years ago

Which of the following chemical reactions proves the fact that the products of photosynthesis are reactants of respiration?

2 answers:

8 0

<span>C6H12O6 + 6O2 ==> 6CO2 + 6H2O
</span><span> This chemical reactions proves the fact that the products of photosynthesis are reactants of respiration
hope it helps</span>

kifflom [539]3 years ago

3 0

Answer:

Reactants Products

Photosynthesis Equation: Energy + Carbon Dioxide + Water = Glucose + Oxygen.

Reactants Products

Cellular Respiration Equation: Glucose + Oxygen = Carbon Dioxide + Water.

Explanation:

You might be interested in

Which anatomical adaptation helps an elephant regulate its body temperature?

trasher [3.6K]

I think the correct answer from the choices listed above is option A. The anatomical adaptation which helps an elephant regulate its body temperature are its large ears increase surface area so that more heat is lost by radiation. Heat can be released as they flap these ears. So there is your correct answer

3 0

2 years ago

Read 2 more answers

Assuming that there is no other variation at the sites not represented, how many SNPs are present at this portion of the sequenc

sleet_krkn [62]

Answer:

1.4 million SNPs are present.

6 0

2 years ago

2. Some proteins within a cell can be viewed with a/an

Cloud [144]

Answer:

Microscope

Explanation:

6 0

2 years ago

Why do producers remove carbon from the atmosphere?

ira [324]

The correct answer is b, photosynthesis.

3 0

2 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago