1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
5

Which of these is responsible for initiating a signal transduction pathway? which of these is responsible for initiating a signa

l transduction pathway? a b c d e?
Biology
1 answer:
Iteru [2.4K]3 years ago
7 0
A single molecule is the one that is responsible for initiating a signal transduction pathway. The answer in this question is a single molecule. Molecule is defined as an electrically neutral group of two atoms or more held together by a chemical bonds.
You might be interested in
One biotic factor that affects consumers in an ocean ecosystem is...
Artist 52 [7]
The answer is A: salt content
6 0
2 years ago
Which type of biotechnology would be used by scientists who use the egg cell of an endangered animal to increase the population
Andrew [12]

Answer:

The answer to this is Genetic Engineering

Explanation:

I hope this was helpful

6 0
2 years ago
Read 2 more answers
Explain why an individual that is heterozygous for this inversion would be partially sterile
Ipatiy [6.2K]
<span>Heterozygotes for inversion have a serious problem chromosome pairing at meiosis and recombination within the characteristic loop leads to chromosome duplication, deficiencies and in some cases two centro meters after recombination in meiosis.The abnormalities are usually not recovered in next generation because gametes or zygotes are receiving them are in-viable.</span>
4 0
3 years ago
Which of the following are organisms? (Choose all that apply)
PolarNik [594]
The answer to your question is bacteria
7 0
1 year ago
The observation that NMDA receptor blockade interferes with performance in the Morris water maze provides an example of a ______
AnnyKZ [126]

The observation that NMDA receptor blockade interferes with performance in the Morris water maze provides an example of a <u>somatic intervention experiment</u> supporting the connection between LTP and memory.

<h3>What is a somatic intervention experiment?</h3>

Somatic Intervention is a technique that allows you to recognize and interrupt habitual patterns (such as anxiety, anger, stress, or fear), release bodily tension and associated memories, and move forward in a more calm and focused manner.

You will learn a new language through Somatic Intervention.

Thus, the correct option is <u>somatic intervention experiment.</u>

<u></u>

Learn more about somatic intervention

brainly.com/question/9651588

#SPJ1

6 0
2 years ago
Other questions:
  • cual es el valorde la razón de cambio cuando metemos un vaso de agua al tiempo al congelador por 15 minutos
    11·1 answer
  • Identify What Kind Of Negative Effects Might A Hurricane Have On A Coastal Ecosystem, Why Do You Think This?
    10·1 answer
  • Macromolecules containing hydrogen oxygen nitrogen carbon phosphorous
    13·1 answer
  • "The graph indicates that the number of species that have become extinct
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Pollution
    7·1 answer
  • Give the symbols for the elements that make up each of the following carbohydrates lipid s DNA proteins
    8·1 answer
  • Help for the brain thing and some points
    7·2 answers
  • Which of the following is a producer in this food web? <br> eggs <br> algae<br> worms
    5·1 answer
  • Plant roots can prevent erosion<br> True or False
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!