ultra violate radition
UV is an environmental human carcinogen. It’s the most prominent and universal cancer-causing agent in our environment. There is very strong evidence that each of the three main types of skin cancer (basal cell carcinoma, squamous cell carcinoma and melanoma) is caused by sun exposure. Research shows that as many as 90% of skin cancers are due to UV radiation.
Natural selection is basically a way for nature to choose what works and what doesn't work. For example, if an animal was born with webs to swim, but most of its food source can be gotten on land, then the animal will die off until it evolves to go on land. That is how evolution works with natural selection. In the past long ago, millions of years back, animals in the water needed oxygen to breath, but the water started to lose it. The land had air, and then the fish slowly grew legs, and their gills would evolve to lungs. Eventually they would be able to roam the land. Because there was so much oxygen with all of the shrubs, trees, and plants, that allowed the bodies of animals to grow big.
The lateral wall of the nasal cavity is formed partly by the maxilla, partly by the ethmoid bone, and partly by the perpendicular part of the palatine bone. Further back, where the nasal cavity becomes the nasopharynx, the lateral wall is formed by the medial pterygoid plate.
Answer:
a virus is a nonliving organism. evidence: a virus is not made up of cells, they can't keep themselves stable, they don't grow, and they can't make their own energy
Explanation:
reasoning: even though they can replicate, they are more like androids/ robots.
The correct answer is TTAATCCTCGGGTCGAAACGGCT
This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.
Adenine -> Thymine
Cytosine -> Guanine
Hope this helps!! :)
