Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Mark Brainliest please
Answer
CF causes thick mucus that clogs certain organs, such as the lungs, pancreas, and intestines. This may cause malnutrition, poor growth, frequent respiratory infections, breathing problems, and chronic lung disease.
The Symptoms of Cystic Fibrosis:
Chronic coughing (dry or coughing up mucus)
Recurring chest colds.
Wheezing or shortness of breath.
Frequent sinus infections.
Very salty-tasting skin.
<span>Animals and plants have cells that are specialized by the process of differentiation.</span>
he three steps in the process of DNA replication are initiation, elongation and termination.
Replication Basics. Replication depends on the pairing of bases between the two strands of DNA. ...
Initiation. ...
Elongation. ...
Termination.
