The southern portion of the region has the highest rates of HIV/Aids.
I hope this helps.
Thomas Malthus was an English scholar and cleric who was known for his views in political science and demography (study of population). His views suggested that population would outpace food the supply of food and that the only vital parameters of population growth were famine, war and diseases. His writings on demography were influential in shaping the economic thinking.
Answer:This protein uses the energy released from hydrolysis of ATP (adenosine triphosphate) to pump three sodium ions out of and two potassium ions into the cell. ... Transport that directly uses ATP for energy is considered primary active transpor
Explanation:
Answer:
C. Mutations always cause a change in the in the way an organism looks.
Explanation:
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
