1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shtirl [24]
3 years ago
12

If two erminette chickens were crossed, what is the probability that: a. They would have a black chick? ________% b. They would

have a white chick? ________%
Biology
1 answer:
lisabon 2012 [21]3 years ago
8 0

Answer:

a. They would have a black chick? 25%

b. They would have a white chick? 25%

You might be interested in
The nucleus of "Lead-208", 208 82 Pb, has 82 protons within a sphere of radius 6.34×10-15 m. Each electric charge has a value of
jarptica [38.1K]

Answer:

2.94 × 10²⁰ N/C

Explanation:

Given that:  

The nucleus of "Lead-208 has 82 protons,

with a radius (r) 6.34×10-15 m, &

each electric charge has a value of 1.60218 × 10^-19 C

∴ The formula for calculating an electrical field at the surface of the nucleus is:

 E=\frac{k*q}{r^2}  

Substituting our values into the equation above, we have;

 E = \frac{8.98755*10^8*82(1.60218*10^{-19C)}}{(6.34*10^{-15}_m)^2}

E = 2.93870499×10²⁰ N/C

E ≅ 2.94 × 10²⁰ N/C

6 0
3 years ago
Describe an example of the cognitive stage, the associative stage, and the autonomous stage during learning the task of operatin
vovikov84 [41]
I don't understand this but can u please help me with history
5 0
3 years ago
Plz help me really wask i am beging for u and thank u ! The conception phase of the product life cycle could be described as dea
topjm [15]

Answer:

B. Manufacturing

Explanation:

because it is

6 0
2 years ago
Which of the following is an example of human capital?
chubhunter [2.5K]

The investment in education and training for people.

6 0
3 years ago
I'LL GIVE BRAINLIEST!!!!! PLEASE HELP!!!!!
Rufina [12.5K]

Answer:

results will be more accurate if there is a larger sample size.  

No matter what research is, the larger sample size is, the more accurately will be the results and vice versa. The larger samples increase a chance of significance because they reflect the population mean more reliably.

With small sample, the chance for false conclusions is higher.

Explanation:

4 0
3 years ago
Other questions:
  • Mexico has more bio diversity than the United States because it is closer to the what
    12·1 answer
  • A group of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. If the mitocho
    5·1 answer
  • Regulating transport of substances in and out of the cell is the
    12·1 answer
  • What are the 5 main function of the skeletal system?
    11·1 answer
  • ____ take longer to decompose so they need to be finely cut
    10·1 answer
  • Glucose is NOT made from which of the following? carbon dioxide sodium chloride light water
    6·2 answers
  • Basalt is a rock that cooled quickly after lava erupted through a volcano. what is the best description of its texture
    11·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is the gap between the two neurons known as?<br><br> motor<br> reflex<br> stimulus<br> synapse
    8·2 answers
  • What do you mean by hypertension??​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!