1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
4 years ago
15

Select all that apply.

Biology
2 answers:
Paul [167]4 years ago
6 0
Molecular compound ; Molecule
Zepler [3.9K]4 years ago
5 0

Molecular compound; Molecule

CO2 is an example of a molecular compound or molecule.

A molecule is the smallest particle of a specific element or compound that retains the chemical properties of that element. Molecules are composed of two or more atoms that are joined together by chemical bonds. Molecules may be simple or complex. Carbon dioxide (CO2) is a molecule that contains one carbon atom bonded to two oxygen atoms.


You might be interested in
Where do male and female gametophytes develop in gymnosperms?
Ksivusya [100]
Gynmosperms are a group of seed producing plants, where the seed are grown on either the leaves (such as a ginko), or scales (such as a pinecone), and gametophytes are found in the same place as seeds, just in a different phase (2 ametes come together to make a seed)
8 0
4 years ago
Fires of wood and paper are what class?
devlian [24]

Answer:

Class A

Explanation:

Because they're combustible materials

4 0
3 years ago
Read 2 more answers
What is the maintenance of a fairly constant internal environment​
Sladkaya [172]

Answer: Maintainance of constant internal environment is carried out in a process called Homeostasis.

Explanation:

Maintainance can of several types such as pH, temperature, and other substances such as Concentration of Ammonia in body. These all should maintain at constantly for stability in body. The maintenance of temperature is called thermo regulation.

5 0
3 years ago
The erosion of rock involves weathering and ____. Help Asap! 20 Points!
alexgriva [62]
Hey there,

<span>The erosion of rock involves weathering and </span>\boxed{deposition}

~Jurgen
4 0
4 years ago
Read 2 more answers
Why we should care that greenhouse gases have been increasing? (2-3 sentences at least please).
Marizza181 [45]

Answer:

We should care about greenhouse gasses becasue, to much of it is causeing global warming. Which causes glaciers/polar ice caps and ice to melt. Greenhouse gasses also cause things like hurricanes, cyclones, typhoons. And sooner or later the ozone layer will break more and will allow radiation to come and heat up the planet more, and can disrupt the atalntic current and then could cause superstorms to start a new ice age. This is why we should care

Explanation:

6 0
3 years ago
Other questions:
  • Helppppp meeeeeeee pleaseeeeeee
    14·1 answer
  • I really need help with this question<br> Describe the diversity of form in the animal kingdom
    15·1 answer
  • Which statement describes how pioneer species and climax communities are different?
    7·2 answers
  • What is photosynthesis an example of?
    13·2 answers
  • Suppose a new data pair with an x-coordinate of 30 was entered into the data set below. If the new data pair followed the same t
    11·1 answer
  • Deficiency disease caused by potassium?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which cell structures would be most affected without food?
    5·1 answer
  • Look at the picture <br>​
    7·1 answer
  • What characteristic do biologists use to classify organism into kingdoms
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!