1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_tiger [21]
3 years ago
13

What was Charles Darwin's scientific breakthough?

Biology
2 answers:
dimaraw [331]3 years ago
6 0
Evolution or Natural Selection fam ;) 

If all else fails, moms spaghetti

Alenkasestr [34]3 years ago
5 0
His scientific breakthrough was the discovery of evolution
You might be interested in
In which period on the geologic time scale are we currently living
Natasha2012 [34]
We are living in the quaternary period
5 0
4 years ago
Read 2 more answers
This lower limb muscle, which attaches to the calcaneus via the calcaneal tendon and plantar flexes the foot when the knee is ex
Hitman42 [59]

Tibialis anterior.

Explanation:

Tibialis anterior is the muscle of lower limb that originates from the upper two-third of lateral surface of tibia and attaches the heel (calcaneous ) via heel cord and plantar.

When the knee is extended, this muscle results in flexing of the foot .

This injury also functions in keeping the balance of the body when we are standing or even when we are walking.

4 0
4 years ago
What are the stages of protein reproduction in order ?
Anestetic [448]
Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.
3 0
3 years ago
Which of these energy resources is the MOST convenient to use (regardless of location)? A. wind B. solar C. natural gas D. hydro
Irina18 [472]
C is the correct answer i believe


7 0
3 years ago
Read 2 more answers
Guanacos: describe one adaptation of this animal
Nata [24]

Answer:

The guanaco is camelid native to South America, closely related to the llama. Its name comes from the Quechua world huanaco. Young guanacos are called chulengos. One of the adaptation of this animal is to socialize. They are garrulous folk, living in herds usually composed of up to ten female, their young, and one dominant male. Baby guancos are adorable and the little four-legged ones can walk competently only five minutes after birth. Female guancos have a lengthy  eleven-and-a-half month gestation period, after which a single chulengo is born between  the South American summer months of December and March.

Explanation:

hope it helps

4 0
3 years ago
Read 2 more answers
Other questions:
  • What tool do we use to measure the amount of force needed to pull an object through the floor
    9·2 answers
  • A grup of individuals of the sale species living together is called a
    9·2 answers
  • All of the factors below play a role in creating ocean currents. Which factor has the greatest influence on weather patterns?
    11·1 answer
  • 8. What can be concluded from the evidence that coughs and sneezes are natural
    7·1 answer
  • A seed has alleles for color (yellow or green) and shape (round or wrinkled). How did Mendel's law of independent assortment des
    11·2 answers
  • The population of the Earth is roughly eight billion people. If all free electrons contained in this extension cord are evenly s
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is a stinging cell that is a distinguishing feature of all cnidarians
    12·1 answer
  • 1. Which sequence places the steps in the correct order? 1. Transfer RNA picks up individual amino acids and carries them to the
    7·1 answer
  • Why do you think the strand of DNA
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!