1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
14

State two ways in which a single-celled organism, such as amoeba and a human body cell are alike

Biology
1 answer:
prohojiy [21]3 years ago
4 0
 <span>they both have genetic information 
and they both contain protein </span>
You might be interested in
What is the main source of human-generated carbon dioxide in the atmosphere? (1 point)
AleksandrR [38]

Answer: A, burning fossil fuels

4 0
3 years ago
PLEASE HELP 20 POINTS
Natasha_Volkova [10]

Answer:

When the meteor hit a caused a chain reaction which caused all that and made some cloud that was toxic.

Explanation:

6 0
3 years ago
Do to Mendel's law of segregation ....?
hram777 [196]

Answer: A

Explanation:

4 0
3 years ago
Biology 1 midterm | ID 210093 generated 9 2019​
Pie

Answer:

Hi there!

Please post questions! Thanks

4 0
4 years ago
Warner is trying hard to complete a biology lab, but it is very difficult. He is more likely to conform to others in this settin
DaniilM [7]

Answer: difficult

Explanation:

The options to the question are:

difficult.

dispositional.

emotional.

elementary.

Following the information in the question regarding the difficulty in the biology lab that Warner wants to compete, if he doesn't complete, then he'll likely conform to others in this setting because the task seems difficult.

3 0
3 years ago
Other questions:
  • Which of the following is an accurate description of an adult stem cell?
    13·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What happens to the amount if available to the amount of energy in the pyramid as it moves up through different levels?
    12·1 answer
  • Which of the following statements is FALSE regarding ecological disturbances? I. Communities that experience moderate disturbanc
    8·1 answer
  • Which of the following is an example of homeostasis?A. Darkening a room makes it easier to sleep. B. Ingesting too much alcohol
    12·1 answer
  • Do they burry people along with their braces?
    9·2 answers
  • 15. Explain how the tilt of the earth causes the seasons. *
    15·1 answer
  • If these three materials all come into contact at once, which direction will thermal energy
    11·1 answer
  • SOMEONE PLZ HELP!!!!!!!!!!!!!
    11·2 answers
  • PLEASE HELP I only have tomorrow morning to get my grade up.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!