1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
3 years ago
9

Can you increase the number of muscle fibers you have ?

Geography
2 answers:
Sergeu [11.5K]3 years ago
6 0
You cannot increase the amount of muscle fibers
IgorC [24]3 years ago
3 0
Yes, you can increase the number of muscle fibers you have. Hope this helps :) 

You might be interested in
5. el cerro
Alexxx [7]
I’m not sure about all, so I’m going to answer the ones that I’m sure.


El río Mississippi
El Golfo de México
7 0
3 years ago
The Mexican Revolution established what form of government in Mexico?
QveST [7]
A democratic republic 
3 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
bakit nasisira ang kalikasan at nagkakaroon ng hidwaan ang mga bansa? ano ang kinalaman ng mga tao dito?​
kap26 [50]

Answer:

I am confused

Explanation:

5 0
3 years ago
Read 2 more answers
How many of the products or foods you tse daily come from Asia's many resources, industries, and ecosystems?
lys-0071 [83]
It’s bhvdvdbrvrbbrbdifkdsirjfkdnf gg f t t t gg
4 0
3 years ago
Other questions:
  • Which term is NOT related to the formation of magma, lava or igneous rock?
    7·2 answers
  • Which of the following rivers is the world's busiest waterway?
    11·2 answers
  • Which is NOT and example of the system of checks and balances at work?
    9·2 answers
  • Does Poland contain large reserves of coal?
    13·1 answer
  • Canada's borders include all of the following except AlaskaArctic OceanGreenlandPacific Ocean
    6·1 answer
  • Remote sensing is:<br>..
    10·2 answers
  • The majority of tribal courts are general jurisdiction courts.
    15·2 answers
  • Two factors that are related to changes in earths temperature are what and what the blank is the measurement upon which all lati
    6·1 answer
  • Which of the following regions is labeled with the number 3 on the map above?
    5·2 answers
  • Contrast the perspectives of members of Congress and of Craig Holman about lobbying
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!