1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
4 years ago
12

Which of the following is a role of lymph nodes?

Biology
1 answer:
maxonik [38]4 years ago
4 0

Answer: They filter lymph.

Explanation: Lymph nodes filter lymph, a fluid that comes from the blood plasma and passes through the lymph nodes; small structures that consist of immune cells. Their function is to engulf foreign parcticles. They prevent these foreign matters from circulating in the blood stream, playing a very important role in the immune system.

You might be interested in
TRUE or FALSE
cupoosta [38]

Answer: I think its False

4 0
3 years ago
Read 2 more answers
What is the fate of the phosphate group that is removed when ATP is converted to ADP? It is acquired by a reactant in an endergo
Alexeev081 [22]

A reactant is a substance that is present (and is modified) in a chemical reaction. Moreover, endergonic reactions are chemical reactions that consume energy.

  • The fate of the phosphate group that is removed when ATP is converted to ADP is that it is acquired by a reactant in an endergonic reaction.

  • ATP synthesis is an endergonic reaction in which ADP and phosphate (Pi) are reactants.

  • ATP is a product that is at a higher energy level than ADP and phosphate (i.e., the reactants), thereby this reaction consumes energy.

Learn more in:

brainly.com/question/1560981?referrer=searchResults

3 0
2 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a ce
prohojiy [21]

Answer:

The statement that best explains the mechanisms of inheritance of gene "The allele for blue is an X-linked dominant allele because there are no blue male offspring in cross 2."

Explanation:

The mechanism for inheritance of gene is the condition, in which the mutation when happens in one allele and cause the effect in the relevant phenotype. Similar inheritance will also be seen when the mutated allele will produce new type of the protein which will have deletorious effect on the normal function of the cell. In case of the single gene, autosomal dominant, autosomal recessive, X-linked dominant, X- linked recessive and mitochondrial are modes of inheritance.

4 0
4 years ago
What condition occurs when hemoglobin is deprived of oxygen?
Artemon [7]
<span>Cyanosis alludes to somewhat blue staining of skin, nail informal lodging layers. Ordinarily, hemoglobin conveys the majority of the oxygen in the blood. This oxygen conveying limit of hemoglobin in the blood is called oxygen saturation.</span>
8 0
4 years ago
Other questions:
  • If the dna sequence of a gene changed from aacttg to aacatg what kind of mutation occurred
    8·2 answers
  • In which solution might a cell maintain homeostasis through diffusion?
    11·1 answer
  • What is a common term for cancerous cells that have spread in the body?
    9·2 answers
  • Living things need small amounts of phosphorous in order to survive.
    5·2 answers
  • What are some traits DNA controls?
    7·2 answers
  • How can i run for Club President if half of the people hate me?
    10·1 answer
  • Hormone receptor complex binds to DNA. 2. Messenger RNA directs synthesis of specific proteins. 3. Hormone binds to receptors in
    7·2 answers
  • What is an important relationship animals have with other organisms in their habitat?
    8·2 answers
  • If Mr. and Mrs. Weasley are a wizard and a witch, what are their genotypes?
    15·1 answer
  • Which of the following would NOT conserve energy from fossil fuels? *
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!